Incidental Mutation 'R5823:Wdr47'
ID450021
Institutional Source Beutler Lab
Gene Symbol Wdr47
Ensembl Gene ENSMUSG00000040389
Gene NameWD repeat domain 47
Synonyms1810073M12Rik
MMRRC Submission 043215-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5823 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location108591279-108645719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108643085 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 809 (V809M)
Ref Sequence ENSEMBL: ENSMUSP00000057482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051145]
Predicted Effect probably damaging
Transcript: ENSMUST00000051145
AA Change: V809M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000057482
Gene: ENSMUSG00000040389
AA Change: V809M

DomainStartEndE-ValueType
LisH 10 42 8.87e-4 SMART
CTLH 45 102 1.93e-13 SMART
low complexity region 137 146 N/A INTRINSIC
low complexity region 226 254 N/A INTRINSIC
coiled coil region 414 455 N/A INTRINSIC
low complexity region 506 523 N/A INTRINSIC
WD40 597 635 7e-4 SMART
WD40 648 690 5.18e-7 SMART
WD40 698 742 2.28e2 SMART
WD40 745 783 9.38e-5 SMART
WD40 790 829 1.31e-3 SMART
WD40 832 871 1.28e-6 SMART
WD40 878 917 7.39e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,930,552 I162N probably damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
4933406M09Rik T A 1: 134,390,917 W476R probably damaging Het
Acsl3 G T 1: 78,688,286 R143L probably benign Het
Ankrd11 A T 8: 122,895,790 I420K probably benign Het
Cwh43 A G 5: 73,411,870 E85G probably benign Het
Dnah1 G T 14: 31,266,418 F3442L possibly damaging Het
Dock6 T A 9: 21,804,828 N1737I probably damaging Het
Fcf1 A G 12: 84,974,147 Y55C possibly damaging Het
Fer1l6 T A 15: 58,590,503 Y802* probably null Het
Fgf9 T G 14: 58,083,302 S10A probably damaging Het
Fhad1 A G 4: 141,955,306 I508T possibly damaging Het
Flnc T C 6: 29,461,202 V2692A probably damaging Het
Gm38119 G T 3: 92,738,073 H71Q unknown Het
Hcn1 A T 13: 117,602,852 H50L unknown Het
Helz2 T C 2: 181,236,396 T870A possibly damaging Het
Iqcf4 T C 9: 106,568,601 I116V probably benign Het
Lama5 T A 2: 180,192,492 I1383F probably benign Het
Lmo2 C T 2: 103,981,072 T150I probably damaging Het
Myh13 A G 11: 67,360,468 E1391G probably damaging Het
Mylk T A 16: 34,894,947 probably null Het
Nat10 A T 2: 103,730,267 V731D probably damaging Het
Ncapd2 A G 6: 125,168,700 V1328A probably benign Het
Nfu1 C A 6: 87,025,559 Q207K probably damaging Het
Nipsnap2 T A 5: 129,739,769 probably null Het
Npc1 T C 18: 12,191,789 K1216E possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Phf3 T C 1: 30,804,683 I1732V probably damaging Het
Rasgrp4 G T 7: 29,137,717 R67L probably benign Het
Rubcn T C 16: 32,849,721 D88G probably damaging Het
Slc30a2 T C 4: 134,345,978 I112T probably damaging Het
Slc35d2 A G 13: 64,120,605 I78T probably damaging Het
Slc9a4 T A 1: 40,619,117 M600K probably damaging Het
Slfn8 A G 11: 83,016,736 I327T probably benign Het
Tas2r118 A G 6: 23,969,471 I197T probably benign Het
Tex15 A G 8: 33,570,934 I405V possibly damaging Het
Thsd7b T C 1: 129,678,084 S521P probably benign Het
Trim36 A G 18: 46,169,340 L535P probably damaging Het
Trim63 A T 4: 134,316,531 I102F probably damaging Het
Other mutations in Wdr47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Wdr47 APN 3 108618734 missense probably benign 0.04
IGL01730:Wdr47 APN 3 108611396 missense probably damaging 1.00
IGL01821:Wdr47 APN 3 108627204 missense probably damaging 1.00
IGL03367:Wdr47 APN 3 108629773 splice site probably benign
R0025:Wdr47 UTSW 3 108637991 missense probably damaging 1.00
R0217:Wdr47 UTSW 3 108637020 missense probably damaging 0.96
R0733:Wdr47 UTSW 3 108618623 missense probably damaging 1.00
R1329:Wdr47 UTSW 3 108627299 missense probably benign 0.14
R1330:Wdr47 UTSW 3 108629753 missense probably benign 0.30
R1894:Wdr47 UTSW 3 108623376 missense possibly damaging 0.56
R2004:Wdr47 UTSW 3 108627442 nonsense probably null
R2040:Wdr47 UTSW 3 108623372 missense probably benign 0.01
R2242:Wdr47 UTSW 3 108619115 missense probably damaging 1.00
R3795:Wdr47 UTSW 3 108624737 critical splice donor site probably null
R5026:Wdr47 UTSW 3 108618522 nonsense probably null
R5732:Wdr47 UTSW 3 108633156 nonsense probably null
R5838:Wdr47 UTSW 3 108624736 critical splice donor site probably null
R5890:Wdr47 UTSW 3 108610012 missense probably damaging 1.00
R5896:Wdr47 UTSW 3 108619006 missense probably damaging 1.00
R5898:Wdr47 UTSW 3 108637885 splice site probably null
R6778:Wdr47 UTSW 3 108633096 missense probably benign 0.16
R7019:Wdr47 UTSW 3 108614355 nonsense probably null
R7051:Wdr47 UTSW 3 108618524 missense probably damaging 1.00
R7535:Wdr47 UTSW 3 108629711 missense probably benign 0.01
R7642:Wdr47 UTSW 3 108643164 missense possibly damaging 0.47
R7709:Wdr47 UTSW 3 108618521 missense probably damaging 1.00
R8048:Wdr47 UTSW 3 108618968 missense probably damaging 0.99
X0062:Wdr47 UTSW 3 108619058 missense probably benign 0.01
Z1177:Wdr47 UTSW 3 108619114 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGACAGACGTGTTTCATTTC -3'
(R):5'- TCGTAAGAGCCTGTCAGCAG -3'

Sequencing Primer
(F):5'- CCTGGCTTCTGAAAAAGATACAGTG -3'
(R):5'- TGTCAGCAGATAGTGAGCTCC -3'
Posted On2016-12-20