Incidental Mutation 'R5823:Slc30a2'
ID450023
Institutional Source Beutler Lab
Gene Symbol Slc30a2
Ensembl Gene ENSMUSG00000028836
Gene Namesolute carrier family 30 (zinc transporter), member 2
SynonymsZnt2
MMRRC Submission 043215-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R5823 (G1)
Quality Score221
Status Not validated
Chromosome4
Chromosomal Location134343181-134354484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134345978 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 112 (I112T)
Ref Sequence ENSEMBL: ENSMUSP00000101500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081094] [ENSMUST00000105872] [ENSMUST00000105873] [ENSMUST00000105874]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081094
AA Change: I32T

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079875
Gene: ENSMUSG00000028836
AA Change: I32T

DomainStartEndE-ValueType
Pfam:Cation_efflux 1 280 6e-64 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105872
AA Change: I32T

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101498
Gene: ENSMUSG00000028836
AA Change: I32T

DomainStartEndE-ValueType
Pfam:Cation_efflux 1 280 6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105873
SMART Domains Protein: ENSMUSP00000101499
Gene: ENSMUSG00000028836

DomainStartEndE-ValueType
Pfam:Cation_efflux 74 311 3.1e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105874
AA Change: I112T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101500
Gene: ENSMUSG00000028836
AA Change: I112T

DomainStartEndE-ValueType
Pfam:Cation_efflux 70 277 3.4e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc transporter that acts as a homodimer. The encoded protein plays a role in secreting zinc into breast milk. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,930,552 I162N probably damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
4933406M09Rik T A 1: 134,390,917 W476R probably damaging Het
Acsl3 G T 1: 78,688,286 R143L probably benign Het
Ankrd11 A T 8: 122,895,790 I420K probably benign Het
Cwh43 A G 5: 73,411,870 E85G probably benign Het
Dnah1 G T 14: 31,266,418 F3442L possibly damaging Het
Dock6 T A 9: 21,804,828 N1737I probably damaging Het
Fcf1 A G 12: 84,974,147 Y55C possibly damaging Het
Fer1l6 T A 15: 58,590,503 Y802* probably null Het
Fgf9 T G 14: 58,083,302 S10A probably damaging Het
Fhad1 A G 4: 141,955,306 I508T possibly damaging Het
Flnc T C 6: 29,461,202 V2692A probably damaging Het
Gm38119 G T 3: 92,738,073 H71Q unknown Het
Hcn1 A T 13: 117,602,852 H50L unknown Het
Helz2 T C 2: 181,236,396 T870A possibly damaging Het
Iqcf4 T C 9: 106,568,601 I116V probably benign Het
Lama5 T A 2: 180,192,492 I1383F probably benign Het
Lmo2 C T 2: 103,981,072 T150I probably damaging Het
Myh13 A G 11: 67,360,468 E1391G probably damaging Het
Mylk T A 16: 34,894,947 probably null Het
Nat10 A T 2: 103,730,267 V731D probably damaging Het
Ncapd2 A G 6: 125,168,700 V1328A probably benign Het
Nfu1 C A 6: 87,025,559 Q207K probably damaging Het
Nipsnap2 T A 5: 129,739,769 probably null Het
Npc1 T C 18: 12,191,789 K1216E possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Phf3 T C 1: 30,804,683 I1732V probably damaging Het
Rasgrp4 G T 7: 29,137,717 R67L probably benign Het
Rubcn T C 16: 32,849,721 D88G probably damaging Het
Slc35d2 A G 13: 64,120,605 I78T probably damaging Het
Slc9a4 T A 1: 40,619,117 M600K probably damaging Het
Slfn8 A G 11: 83,016,736 I327T probably benign Het
Tas2r118 A G 6: 23,969,471 I197T probably benign Het
Tex15 A G 8: 33,570,934 I405V possibly damaging Het
Thsd7b T C 1: 129,678,084 S521P probably benign Het
Trim36 A G 18: 46,169,340 L535P probably damaging Het
Trim63 A T 4: 134,316,531 I102F probably damaging Het
Wdr47 G A 3: 108,643,085 V809M probably damaging Het
Other mutations in Slc30a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Slc30a2 APN 4 134343300 missense probably damaging 0.96
IGL01822:Slc30a2 APN 4 134348637 missense probably damaging 0.98
IGL02808:Slc30a2 APN 4 134344049 missense possibly damaging 0.65
R1415:Slc30a2 UTSW 4 134349349 missense probably damaging 1.00
R2279:Slc30a2 UTSW 4 134348546 missense probably benign
R4151:Slc30a2 UTSW 4 134344048 missense probably benign 0.00
R4278:Slc30a2 UTSW 4 134346049 missense probably null 1.00
R4783:Slc30a2 UTSW 4 134344006 critical splice acceptor site probably null
R7017:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7018:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7021:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7034:Slc30a2 UTSW 4 134347342 missense possibly damaging 0.80
R7053:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7056:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7057:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7067:Slc30a2 UTSW 4 134344218 critical splice donor site probably null
R7138:Slc30a2 UTSW 4 134344118 missense probably benign 0.00
R7275:Slc30a2 UTSW 4 134349270 splice site probably null
R7289:Slc30a2 UTSW 4 134344213 missense possibly damaging 0.69
R8015:Slc30a2 UTSW 4 134347450 missense probably benign 0.01
Z1176:Slc30a2 UTSW 4 134344089 missense probably benign 0.00
Z1177:Slc30a2 UTSW 4 134347455 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACCCAATTTGGCTCATCTTCTAGG -3'
(R):5'- AGAACTCCAAGACTAGCTGGG -3'

Sequencing Primer
(F):5'- CAATTTGGCTCATCTTCTAGGGTGTG -3'
(R):5'- GCCTTGGTTACTTACAAGCTCAAGG -3'
Posted On2016-12-20