Incidental Mutation 'R5823:Nipsnap2'
ID450026
Institutional Source Beutler Lab
Gene Symbol Nipsnap2
Ensembl Gene ENSMUSG00000029432
Gene Namenipsnap homolog 2
SynonymsGbas, Nipsnap2
MMRRC Submission 043215-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5823 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location129725063-129758327 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to A at 129739769 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086046] [ENSMUST00000124342] [ENSMUST00000186265] [ENSMUST00000186265] [ENSMUST00000195946]
Predicted Effect probably null
Transcript: ENSMUST00000086046
SMART Domains Protein: ENSMUSP00000083211
Gene: ENSMUSG00000029432

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:NIPSNAP 182 279 2.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124342
SMART Domains Protein: ENSMUSP00000117705
Gene: ENSMUSG00000029432

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:NIPSNAP 182 279 2.8e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000186265
SMART Domains Protein: ENSMUSP00000141131
Gene: ENSMUSG00000029432

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:NIPSNAP 182 279 2.8e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000186265
SMART Domains Protein: ENSMUSP00000141131
Gene: ENSMUSG00000029432

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:NIPSNAP 182 279 2.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195946
SMART Domains Protein: ENSMUSP00000142916
Gene: ENSMUSG00000029432

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NipSnap family of proteins that may be involved in vesicular transport. The encoded protein is localized to mitochondria and plays a role in oxidative phosphorylation. A pseudogene of this gene is located on the long arm of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,930,552 I162N probably damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
4933406M09Rik T A 1: 134,390,917 W476R probably damaging Het
Acsl3 G T 1: 78,688,286 R143L probably benign Het
Ankrd11 A T 8: 122,895,790 I420K probably benign Het
Cwh43 A G 5: 73,411,870 E85G probably benign Het
Dnah1 G T 14: 31,266,418 F3442L possibly damaging Het
Dock6 T A 9: 21,804,828 N1737I probably damaging Het
Fcf1 A G 12: 84,974,147 Y55C possibly damaging Het
Fer1l6 T A 15: 58,590,503 Y802* probably null Het
Fgf9 T G 14: 58,083,302 S10A probably damaging Het
Fhad1 A G 4: 141,955,306 I508T possibly damaging Het
Flnc T C 6: 29,461,202 V2692A probably damaging Het
Gm38119 G T 3: 92,738,073 H71Q unknown Het
Hcn1 A T 13: 117,602,852 H50L unknown Het
Helz2 T C 2: 181,236,396 T870A possibly damaging Het
Iqcf4 T C 9: 106,568,601 I116V probably benign Het
Lama5 T A 2: 180,192,492 I1383F probably benign Het
Lmo2 C T 2: 103,981,072 T150I probably damaging Het
Myh13 A G 11: 67,360,468 E1391G probably damaging Het
Mylk T A 16: 34,894,947 probably null Het
Nat10 A T 2: 103,730,267 V731D probably damaging Het
Ncapd2 A G 6: 125,168,700 V1328A probably benign Het
Nfu1 C A 6: 87,025,559 Q207K probably damaging Het
Npc1 T C 18: 12,191,789 K1216E possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Phf3 T C 1: 30,804,683 I1732V probably damaging Het
Rasgrp4 G T 7: 29,137,717 R67L probably benign Het
Rubcn T C 16: 32,849,721 D88G probably damaging Het
Slc30a2 T C 4: 134,345,978 I112T probably damaging Het
Slc35d2 A G 13: 64,120,605 I78T probably damaging Het
Slc9a4 T A 1: 40,619,117 M600K probably damaging Het
Slfn8 A G 11: 83,016,736 I327T probably benign Het
Tas2r118 A G 6: 23,969,471 I197T probably benign Het
Tex15 A G 8: 33,570,934 I405V possibly damaging Het
Thsd7b T C 1: 129,678,084 S521P probably benign Het
Trim36 A G 18: 46,169,340 L535P probably damaging Het
Trim63 A T 4: 134,316,531 I102F probably damaging Het
Wdr47 G A 3: 108,643,085 V809M probably damaging Het
Other mutations in Nipsnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Nipsnap2 APN 5 129754851 missense probably damaging 0.99
IGL01012:Nipsnap2 APN 5 129746439 missense possibly damaging 0.91
IGL01320:Nipsnap2 APN 5 129744764 missense probably damaging 1.00
IGL01321:Nipsnap2 APN 5 129757141 makesense probably null
IGL02119:Nipsnap2 APN 5 129747992 splice site probably benign
IGL02636:Nipsnap2 APN 5 129745290 intron probably benign
R0540:Nipsnap2 UTSW 5 129754845 missense probably damaging 1.00
R1497:Nipsnap2 UTSW 5 129753218 intron probably benign
R1649:Nipsnap2 UTSW 5 129753237 missense probably damaging 0.99
R1743:Nipsnap2 UTSW 5 129757085 missense probably damaging 1.00
R2020:Nipsnap2 UTSW 5 129753223 splice site probably null
R2187:Nipsnap2 UTSW 5 129746473 splice site probably null
R2215:Nipsnap2 UTSW 5 129739585 missense probably damaging 1.00
R2430:Nipsnap2 UTSW 5 129744791 missense possibly damaging 0.94
R3124:Nipsnap2 UTSW 5 129748034 critical splice donor site probably null
R5072:Nipsnap2 UTSW 5 129739580 missense probably damaging 1.00
R5150:Nipsnap2 UTSW 5 129757111 missense probably benign 0.03
R6736:Nipsnap2 UTSW 5 129745288 critical splice donor site probably null
R6913:Nipsnap2 UTSW 5 129753293 missense probably benign 0.11
R7163:Nipsnap2 UTSW 5 129744710 missense probably benign 0.00
R7597:Nipsnap2 UTSW 5 129739573 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACGAGCAGTCTGTACAAGTTAC -3'
(R):5'- GTCCCGATTGAGCAAACTGTG -3'

Sequencing Primer
(F):5'- TTACAGTGTGAGTAGCGGCCC -3'
(R):5'- TGAGTGCTTAAAGGTGCCCC -3'
Posted On2016-12-20