Incidental Mutation 'R5823:1600015I10Rik'
ID450030
Institutional Source Beutler Lab
Gene Symbol 1600015I10Rik
Ensembl Gene ENSMUSG00000029813
Gene NameRIKEN cDNA 1600015I10 gene
Synonyms
MMRRC Submission 043215-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R5823 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location48929895-48933687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48930552 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 162 (I162N)
Ref Sequence ENSEMBL: ENSMUSP00000031837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031837]
Predicted Effect probably damaging
Transcript: ENSMUST00000031837
AA Change: I162N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031837
Gene: ENSMUSG00000029813
AA Change: I162N

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 50 136 1.7e-25 PFAM
Pfam:Cu_amine_oxidN3 152 252 3.5e-16 PFAM
Pfam:Cu_amine_oxid 306 708 7.1e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158710
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
4933406M09Rik T A 1: 134,390,917 W476R probably damaging Het
Acsl3 G T 1: 78,688,286 R143L probably benign Het
Ankrd11 A T 8: 122,895,790 I420K probably benign Het
Cwh43 A G 5: 73,411,870 E85G probably benign Het
Dnah1 G T 14: 31,266,418 F3442L possibly damaging Het
Dock6 T A 9: 21,804,828 N1737I probably damaging Het
Fcf1 A G 12: 84,974,147 Y55C possibly damaging Het
Fer1l6 T A 15: 58,590,503 Y802* probably null Het
Fgf9 T G 14: 58,083,302 S10A probably damaging Het
Fhad1 A G 4: 141,955,306 I508T possibly damaging Het
Flnc T C 6: 29,461,202 V2692A probably damaging Het
Gm38119 G T 3: 92,738,073 H71Q unknown Het
Hcn1 A T 13: 117,602,852 H50L unknown Het
Helz2 T C 2: 181,236,396 T870A possibly damaging Het
Iqcf4 T C 9: 106,568,601 I116V probably benign Het
Lama5 T A 2: 180,192,492 I1383F probably benign Het
Lmo2 C T 2: 103,981,072 T150I probably damaging Het
Myh13 A G 11: 67,360,468 E1391G probably damaging Het
Mylk T A 16: 34,894,947 probably null Het
Nat10 A T 2: 103,730,267 V731D probably damaging Het
Ncapd2 A G 6: 125,168,700 V1328A probably benign Het
Nfu1 C A 6: 87,025,559 Q207K probably damaging Het
Nipsnap2 T A 5: 129,739,769 probably null Het
Npc1 T C 18: 12,191,789 K1216E possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Phf3 T C 1: 30,804,683 I1732V probably damaging Het
Rasgrp4 G T 7: 29,137,717 R67L probably benign Het
Rubcn T C 16: 32,849,721 D88G probably damaging Het
Slc30a2 T C 4: 134,345,978 I112T probably damaging Het
Slc35d2 A G 13: 64,120,605 I78T probably damaging Het
Slc9a4 T A 1: 40,619,117 M600K probably damaging Het
Slfn8 A G 11: 83,016,736 I327T probably benign Het
Tas2r118 A G 6: 23,969,471 I197T probably benign Het
Tex15 A G 8: 33,570,934 I405V possibly damaging Het
Thsd7b T C 1: 129,678,084 S521P probably benign Het
Trim36 A G 18: 46,169,340 L535P probably damaging Het
Trim63 A T 4: 134,316,531 I102F probably damaging Het
Wdr47 G A 3: 108,643,085 V809M probably damaging Het
Other mutations in 1600015I10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:1600015I10Rik APN 6 48931040 missense probably damaging 1.00
IGL01347:1600015I10Rik APN 6 48932543 missense probably benign 0.02
IGL01751:1600015I10Rik APN 6 48930588 missense possibly damaging 0.79
IGL01915:1600015I10Rik APN 6 48931648 missense probably damaging 1.00
IGL02669:1600015I10Rik APN 6 48931473 missense probably damaging 1.00
IGL03033:1600015I10Rik APN 6 48932518 missense probably benign 0.00
IGL03242:1600015I10Rik APN 6 48932545 missense possibly damaging 0.68
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0448:1600015I10Rik UTSW 6 48933057 missense probably damaging 1.00
R1488:1600015I10Rik UTSW 6 48933447 missense possibly damaging 0.91
R1498:1600015I10Rik UTSW 6 48931371 missense probably benign 0.00
R1520:1600015I10Rik UTSW 6 48931297 nonsense probably null
R1922:1600015I10Rik UTSW 6 48931286 missense probably benign 0.00
R1992:1600015I10Rik UTSW 6 48930769 missense probably damaging 1.00
R1997:1600015I10Rik UTSW 6 48932429 missense probably damaging 0.98
R2021:1600015I10Rik UTSW 6 48931451 missense probably damaging 1.00
R3771:1600015I10Rik UTSW 6 48931196 missense probably damaging 1.00
R4208:1600015I10Rik UTSW 6 48931647 missense probably damaging 1.00
R4790:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5114:1600015I10Rik UTSW 6 48931358 missense probably benign 0.02
R5610:1600015I10Rik UTSW 6 48931019 missense probably benign 0.00
R5847:1600015I10Rik UTSW 6 48933478 missense probably damaging 1.00
R6233:1600015I10Rik UTSW 6 48930965 missense probably benign
R6357:1600015I10Rik UTSW 6 48930974 missense probably benign 0.00
R6694:1600015I10Rik UTSW 6 48930546 missense probably benign 0.21
R6733:1600015I10Rik UTSW 6 48930530 missense probably damaging 1.00
R6894:1600015I10Rik UTSW 6 48930662 missense probably damaging 1.00
R6898:1600015I10Rik UTSW 6 48931041 missense probably damaging 0.97
R6916:1600015I10Rik UTSW 6 48931053 missense probably benign 0.01
R7242:1600015I10Rik UTSW 6 48931128 missense probably damaging 1.00
R7762:1600015I10Rik UTSW 6 48932686 missense probably benign 0.07
R8257:1600015I10Rik UTSW 6 48932497 missense probably benign 0.04
R8391:1600015I10Rik UTSW 6 48932668 missense probably damaging 0.96
X0062:1600015I10Rik UTSW 6 48933132 missense possibly damaging 0.55
Z1176:1600015I10Rik UTSW 6 48932468 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AATGCTGCTGCCCGATAAG -3'
(R):5'- ATAGCGTTGCAACATGAACC -3'

Sequencing Primer
(F):5'- TGCTAGATTTTCTGGACAAAGGAG -3'
(R):5'- GTTGCAACATGAACCAGCTACAG -3'
Posted On2016-12-20