Incidental Mutation 'R5823:Dock6'
ID450039
Institutional Source Beutler Lab
Gene Symbol Dock6
Ensembl Gene ENSMUSG00000032198
Gene Namededicator of cytokinesis 6
Synonyms2410095B20Rik, C330023D02Rik, 4931431C02Rik
MMRRC Submission 043215-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.479) question?
Stock #R5823 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21799860-21852635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21804828 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 1737 (N1737I)
Ref Sequence ENSEMBL: ENSMUSP00000034728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034728] [ENSMUST00000217336]
Predicted Effect probably damaging
Transcript: ENSMUST00000034728
AA Change: N1737I

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034728
Gene: ENSMUSG00000032198
AA Change: N1737I

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Pfam:DUF3398 63 155 4.7e-26 PFAM
low complexity region 419 429 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
Pfam:DOCK-C2 542 721 3.4e-46 PFAM
low complexity region 754 770 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 945 965 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
low complexity region 1123 1153 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
Pfam:DHR-2 1554 2080 6.6e-214 PFAM
low complexity region 2093 2107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217310
Predicted Effect probably benign
Transcript: ENSMUST00000217336
AA Change: N1768I

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis (DOCK) family of atypical guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with small GTPases and are components of intracellular signaling networks. The encoded protein is a group C DOCK protein and plays a role in actin cytoskeletal reorganization by activating the Rho GTPases Cdc42 and Rac1. Mutations in this gene are associated with Adams-Oliver syndrome 2. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,930,552 I162N probably damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
4933406M09Rik T A 1: 134,390,917 W476R probably damaging Het
Acsl3 G T 1: 78,688,286 R143L probably benign Het
Ankrd11 A T 8: 122,895,790 I420K probably benign Het
Cwh43 A G 5: 73,411,870 E85G probably benign Het
Dnah1 G T 14: 31,266,418 F3442L possibly damaging Het
Fcf1 A G 12: 84,974,147 Y55C possibly damaging Het
Fer1l6 T A 15: 58,590,503 Y802* probably null Het
Fgf9 T G 14: 58,083,302 S10A probably damaging Het
Fhad1 A G 4: 141,955,306 I508T possibly damaging Het
Flnc T C 6: 29,461,202 V2692A probably damaging Het
Gm38119 G T 3: 92,738,073 H71Q unknown Het
Hcn1 A T 13: 117,602,852 H50L unknown Het
Helz2 T C 2: 181,236,396 T870A possibly damaging Het
Iqcf4 T C 9: 106,568,601 I116V probably benign Het
Lama5 T A 2: 180,192,492 I1383F probably benign Het
Lmo2 C T 2: 103,981,072 T150I probably damaging Het
Myh13 A G 11: 67,360,468 E1391G probably damaging Het
Mylk T A 16: 34,894,947 probably null Het
Nat10 A T 2: 103,730,267 V731D probably damaging Het
Ncapd2 A G 6: 125,168,700 V1328A probably benign Het
Nfu1 C A 6: 87,025,559 Q207K probably damaging Het
Nipsnap2 T A 5: 129,739,769 probably null Het
Npc1 T C 18: 12,191,789 K1216E possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Phf3 T C 1: 30,804,683 I1732V probably damaging Het
Rasgrp4 G T 7: 29,137,717 R67L probably benign Het
Rubcn T C 16: 32,849,721 D88G probably damaging Het
Slc30a2 T C 4: 134,345,978 I112T probably damaging Het
Slc35d2 A G 13: 64,120,605 I78T probably damaging Het
Slc9a4 T A 1: 40,619,117 M600K probably damaging Het
Slfn8 A G 11: 83,016,736 I327T probably benign Het
Tas2r118 A G 6: 23,969,471 I197T probably benign Het
Tex15 A G 8: 33,570,934 I405V possibly damaging Het
Thsd7b T C 1: 129,678,084 S521P probably benign Het
Trim36 A G 18: 46,169,340 L535P probably damaging Het
Trim63 A T 4: 134,316,531 I102F probably damaging Het
Wdr47 G A 3: 108,643,085 V809M probably damaging Het
Other mutations in Dock6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Dock6 APN 9 21846634 missense possibly damaging 0.50
IGL01025:Dock6 APN 9 21811807 missense possibly damaging 0.89
IGL01390:Dock6 APN 9 21803045 missense probably damaging 1.00
IGL02025:Dock6 APN 9 21809589 missense probably damaging 0.98
IGL02028:Dock6 APN 9 21838826 missense probably damaging 1.00
IGL02311:Dock6 APN 9 21844328 missense probably damaging 1.00
IGL02441:Dock6 APN 9 21841926 missense possibly damaging 0.77
IGL02504:Dock6 APN 9 21846655 missense probably benign 0.19
IGL02516:Dock6 APN 9 21802585 missense probably damaging 1.00
IGL02836:Dock6 APN 9 21801864 missense probably damaging 1.00
IGL02894:Dock6 APN 9 21811815 missense probably damaging 1.00
bayfront UTSW 9 21821745 missense probably benign 0.29
IGL03048:Dock6 UTSW 9 21809570 missense probably damaging 1.00
R0370:Dock6 UTSW 9 21814565 missense probably benign 0.29
R0504:Dock6 UTSW 9 21802436 missense probably damaging 1.00
R0633:Dock6 UTSW 9 21844417 missense probably benign 0.00
R0634:Dock6 UTSW 9 21841527 missense probably damaging 1.00
R0671:Dock6 UTSW 9 21804627 splice site probably benign
R0839:Dock6 UTSW 9 21817892 missense probably benign 0.01
R0948:Dock6 UTSW 9 21801533 missense probably damaging 1.00
R1022:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1024:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1073:Dock6 UTSW 9 21846518 missense probably benign
R1463:Dock6 UTSW 9 21831906 missense probably damaging 1.00
R1481:Dock6 UTSW 9 21820622 missense probably benign
R1494:Dock6 UTSW 9 21814742 missense probably benign 0.34
R1547:Dock6 UTSW 9 21814588 missense probably damaging 1.00
R1654:Dock6 UTSW 9 21804843 missense probably damaging 0.98
R1782:Dock6 UTSW 9 21811846 missense probably damaging 1.00
R1905:Dock6 UTSW 9 21829574 missense probably benign 0.37
R1908:Dock6 UTSW 9 21841629 missense probably damaging 1.00
R1916:Dock6 UTSW 9 21813091 missense probably damaging 1.00
R2132:Dock6 UTSW 9 21846518 missense probably benign
R2197:Dock6 UTSW 9 21832881 missense probably damaging 1.00
R2316:Dock6 UTSW 9 21839677 missense probably damaging 0.98
R2341:Dock6 UTSW 9 21839486 splice site probably benign
R2519:Dock6 UTSW 9 21816333 missense possibly damaging 0.54
R2924:Dock6 UTSW 9 21809630 missense probably damaging 1.00
R2939:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R2940:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3078:Dock6 UTSW 9 21845754 splice site probably benign
R3081:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3810:Dock6 UTSW 9 21801577 missense probably damaging 1.00
R4246:Dock6 UTSW 9 21839490 splice site probably null
R4604:Dock6 UTSW 9 21802540 missense probably damaging 1.00
R4833:Dock6 UTSW 9 21844280 missense probably damaging 1.00
R4849:Dock6 UTSW 9 21811772 critical splice donor site probably null
R4896:Dock6 UTSW 9 21824437 missense possibly damaging 0.48
R4926:Dock6 UTSW 9 21845791 missense probably damaging 1.00
R5183:Dock6 UTSW 9 21841603 missense probably benign 0.00
R5211:Dock6 UTSW 9 21820352 missense probably benign 0.36
R5337:Dock6 UTSW 9 21829548 missense possibly damaging 0.93
R5353:Dock6 UTSW 9 21814786 missense probably benign 0.00
R5429:Dock6 UTSW 9 21832881 missense probably damaging 0.99
R5463:Dock6 UTSW 9 21809958 splice site probably null
R5476:Dock6 UTSW 9 21809589 missense probably damaging 0.98
R5511:Dock6 UTSW 9 21817407 missense possibly damaging 0.59
R5534:Dock6 UTSW 9 21803076 nonsense probably null
R5718:Dock6 UTSW 9 21824493 missense probably benign 0.11
R5831:Dock6 UTSW 9 21803036 missense probably damaging 1.00
R5887:Dock6 UTSW 9 21820394 missense probably damaging 0.96
R5930:Dock6 UTSW 9 21824416 missense probably benign 0.29
R6159:Dock6 UTSW 9 21821745 missense probably benign 0.29
R6633:Dock6 UTSW 9 21820331 missense probably benign 0.17
R6633:Dock6 UTSW 9 21821503 missense probably damaging 1.00
R6665:Dock6 UTSW 9 21839912 missense probably damaging 0.99
R6744:Dock6 UTSW 9 21831474 missense probably damaging 1.00
R6903:Dock6 UTSW 9 21809564 missense probably damaging 1.00
R6981:Dock6 UTSW 9 21845550 missense probably damaging 0.99
R7024:Dock6 UTSW 9 21820370 missense probably benign
R7030:Dock6 UTSW 9 21813079 missense probably damaging 1.00
R7045:Dock6 UTSW 9 21821811 missense probably damaging 1.00
R7139:Dock6 UTSW 9 21801276 missense probably damaging 1.00
R7356:Dock6 UTSW 9 21809899 missense probably damaging 1.00
R7400:Dock6 UTSW 9 21801807 missense possibly damaging 0.62
R7847:Dock6 UTSW 9 21801207 missense unknown
R7863:Dock6 UTSW 9 21846658 missense possibly damaging 0.85
R7991:Dock6 UTSW 9 21846562 missense probably damaging 1.00
R7992:Dock6 UTSW 9 21832839 critical splice donor site probably null
R8012:Dock6 UTSW 9 21846511 missense probably benign 0.16
R8184:Dock6 UTSW 9 21830300 missense possibly damaging 0.54
R8213:Dock6 UTSW 9 21831444 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AAGATTAGGGGTCCCAGGTC -3'
(R):5'- AGAATCCACAGGCCTTGGAC -3'

Sequencing Primer
(F):5'- TTAGGGGTCCCAGGTCAAGGAG -3'
(R):5'- ACAGGCCTTGGACCTTGGTAG -3'
Posted On2016-12-20