Incidental Mutation 'R5823:Hcn1'
ID450048
Institutional Source Beutler Lab
Gene Symbol Hcn1
Ensembl Gene ENSMUSG00000021730
Gene Namehyperpolarization-activated, cyclic nucleotide-gated K+ 1
SynonymsHAC2, Bcng1, C630013B14Rik
MMRRC Submission 043215-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5823 (G1)
Quality Score200
Status Not validated
Chromosome13
Chromosomal Location117602320-117987418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117602852 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 50 (H50L)
Ref Sequence ENSEMBL: ENSMUSP00000006991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006991]
PDB Structure
Tetramerization dynamics of the C-terminus underlies isoform-specific cAMP-gating in HCN channels [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000006991
AA Change: H50L
SMART Domains Protein: ENSMUSP00000006991
Gene: ENSMUSG00000021730
AA Change: H50L

DomainStartEndE-ValueType
Pfam:Ion_trans_N 87 130 8.2e-24 PFAM
Pfam:Ion_trans 131 394 2.1e-23 PFAM
low complexity region 395 406 N/A INTRINSIC
Blast:cNMP 407 439 4e-13 BLAST
cNMP 464 580 1.95e-22 SMART
low complexity region 639 655 N/A INTRINSIC
low complexity region 660 680 N/A INTRINSIC
low complexity region 720 779 N/A INTRINSIC
low complexity region 878 886 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207599
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a hyperpolarization-activated cation channel that contributes to the native pacemaker currents in heart and neurons. The encoded protein can homodimerize or heterodimerize with other pore-forming subunits to form a potassium channel. This channel may act as a receptor for sour tastes. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this allele display learning deficiencies but are otherwise normal. Mice homozygous for another targeted knock-out exhibit deficit in hyperpolarization-activated currents and cold allodynia following partial nerve ligation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,930,552 I162N probably damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
4933406M09Rik T A 1: 134,390,917 W476R probably damaging Het
Acsl3 G T 1: 78,688,286 R143L probably benign Het
Ankrd11 A T 8: 122,895,790 I420K probably benign Het
Cwh43 A G 5: 73,411,870 E85G probably benign Het
Dnah1 G T 14: 31,266,418 F3442L possibly damaging Het
Dock6 T A 9: 21,804,828 N1737I probably damaging Het
Fcf1 A G 12: 84,974,147 Y55C possibly damaging Het
Fer1l6 T A 15: 58,590,503 Y802* probably null Het
Fgf9 T G 14: 58,083,302 S10A probably damaging Het
Fhad1 A G 4: 141,955,306 I508T possibly damaging Het
Flnc T C 6: 29,461,202 V2692A probably damaging Het
Gm38119 G T 3: 92,738,073 H71Q unknown Het
Helz2 T C 2: 181,236,396 T870A possibly damaging Het
Iqcf4 T C 9: 106,568,601 I116V probably benign Het
Lama5 T A 2: 180,192,492 I1383F probably benign Het
Lmo2 C T 2: 103,981,072 T150I probably damaging Het
Myh13 A G 11: 67,360,468 E1391G probably damaging Het
Mylk T A 16: 34,894,947 probably null Het
Nat10 A T 2: 103,730,267 V731D probably damaging Het
Ncapd2 A G 6: 125,168,700 V1328A probably benign Het
Nfu1 C A 6: 87,025,559 Q207K probably damaging Het
Nipsnap2 T A 5: 129,739,769 probably null Het
Npc1 T C 18: 12,191,789 K1216E possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Phf3 T C 1: 30,804,683 I1732V probably damaging Het
Rasgrp4 G T 7: 29,137,717 R67L probably benign Het
Rubcn T C 16: 32,849,721 D88G probably damaging Het
Slc30a2 T C 4: 134,345,978 I112T probably damaging Het
Slc35d2 A G 13: 64,120,605 I78T probably damaging Het
Slc9a4 T A 1: 40,619,117 M600K probably damaging Het
Slfn8 A G 11: 83,016,736 I327T probably benign Het
Tas2r118 A G 6: 23,969,471 I197T probably benign Het
Tex15 A G 8: 33,570,934 I405V possibly damaging Het
Thsd7b T C 1: 129,678,084 S521P probably benign Het
Trim36 A G 18: 46,169,340 L535P probably damaging Het
Trim63 A T 4: 134,316,531 I102F probably damaging Het
Wdr47 G A 3: 108,643,085 V809M probably damaging Het
Other mutations in Hcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Hcn1 APN 13 117975993 missense probably damaging 1.00
IGL00340:Hcn1 APN 13 117602977 missense unknown
IGL01161:Hcn1 APN 13 117656922 missense unknown
IGL01723:Hcn1 APN 13 117976055 missense probably damaging 0.98
IGL02324:Hcn1 APN 13 117902886 missense unknown
IGL02491:Hcn1 APN 13 117810040 missense unknown
Thump UTSW 13 117873905 nonsense probably null
FR4976:Hcn1 UTSW 13 117975808 small insertion probably benign
PIT4504001:Hcn1 UTSW 13 117975875 missense possibly damaging 0.90
R0420:Hcn1 UTSW 13 117975375 missense unknown
R1546:Hcn1 UTSW 13 117975766 small insertion probably benign
R1558:Hcn1 UTSW 13 117975576 missense unknown
R1659:Hcn1 UTSW 13 117976074 missense probably damaging 0.99
R1667:Hcn1 UTSW 13 117603073 missense unknown
R1766:Hcn1 UTSW 13 117656734 missense probably benign 0.39
R1842:Hcn1 UTSW 13 117976008 missense probably damaging 0.99
R2051:Hcn1 UTSW 13 117976083 missense probably damaging 0.99
R3605:Hcn1 UTSW 13 117975252 missense unknown
R4259:Hcn1 UTSW 13 117975348 missense unknown
R4284:Hcn1 UTSW 13 117975733 small deletion probably benign
R4637:Hcn1 UTSW 13 117975713 missense unknown
R4679:Hcn1 UTSW 13 117657015 missense probably benign 0.39
R4777:Hcn1 UTSW 13 117975733 small deletion probably benign
R4839:Hcn1 UTSW 13 117925710 missense unknown
R4883:Hcn1 UTSW 13 117902895 critical splice donor site probably null
R5015:Hcn1 UTSW 13 117603020 missense unknown
R5060:Hcn1 UTSW 13 117873905 nonsense probably null
R5748:Hcn1 UTSW 13 117976055 missense probably damaging 0.99
R6900:Hcn1 UTSW 13 117656827 missense probably benign 0.39
R7045:Hcn1 UTSW 13 117975462 missense unknown
R7049:Hcn1 UTSW 13 117975462 missense unknown
R7163:Hcn1 UTSW 13 117925547 missense unknown
R7534:Hcn1 UTSW 13 117975425 missense unknown
R7722:Hcn1 UTSW 13 117902778 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTTCAATGTCACGCTGGG -3'
(R):5'- TTCTGGCTCCCAAACATGCG -3'

Sequencing Primer
(F):5'- GCCTCAGCCTCAGTACCAG -3'
(R):5'- GGAGGGAGAATTTGTTGACCCC -3'
Posted On2016-12-20