Incidental Mutation 'R5823:Rubcn'
ID450052
Institutional Source Beutler Lab
Gene Symbol Rubcn
Ensembl Gene ENSMUSG00000035629
Gene NameRUN domain and cysteine-rich domain containing, Beclin 1-interacting protein
Synonyms1700021K19Rik
MMRRC Submission 043215-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock #R5823 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location32821703-32877766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32849721 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 88 (D88G)
Ref Sequence ENSEMBL: ENSMUSP00000155943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040986] [ENSMUST00000089684] [ENSMUST00000115105] [ENSMUST00000119810] [ENSMUST00000231478] [ENSMUST00000232269]
Predicted Effect probably damaging
Transcript: ENSMUST00000040986
AA Change: D88G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048811
Gene: ENSMUSG00000035629
AA Change: D88G

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RUN 123 183 1.67e-15 SMART
low complexity region 230 254 N/A INTRINSIC
low complexity region 339 371 N/A INTRINSIC
Blast:DUF4206 469 687 1e-66 BLAST
DUF4206 706 908 1.66e-113 SMART
low complexity region 915 941 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000089684
AA Change: D88G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000087114
Gene: ENSMUSG00000035629
AA Change: D88G

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RUN 123 183 1.67e-15 SMART
low complexity region 230 254 N/A INTRINSIC
low complexity region 339 371 N/A INTRINSIC
Blast:DUF4206 484 702 1e-66 BLAST
DUF4206 721 923 1.66e-113 SMART
low complexity region 930 956 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115105
AA Change: D88G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110757
Gene: ENSMUSG00000035629
AA Change: D88G

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RUN 123 183 1.67e-15 SMART
low complexity region 230 254 N/A INTRINSIC
low complexity region 340 357 N/A INTRINSIC
Blast:DUF4206 455 673 1e-66 BLAST
DUF4206 692 894 1.66e-113 SMART
low complexity region 901 927 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119810
AA Change: D27G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113087
Gene: ENSMUSG00000035629
AA Change: D27G

DomainStartEndE-ValueType
RUN 62 122 1.67e-15 SMART
low complexity region 169 193 N/A INTRINSIC
low complexity region 278 310 N/A INTRINSIC
Blast:DUF4206 408 626 6e-67 BLAST
DUF4206 645 847 1.66e-113 SMART
low complexity region 854 880 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231478
AA Change: D88G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000232269
AA Change: D88G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a negative regulator of autophagy and endocytic trafficking and controls endosome maturation. This protein contains two conserved domains, an N-terminal RUN domain and a C-terminal DUF4206 domain. The RUN domain is involved in Ras-like GTPase signaling, and the DUF4206 domain contains a diacylglycerol (DAG) binding-like motif. Mutation in this gene results in deletion of the DAG binding-like motif and causes a recessive ataxia. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,930,552 I162N probably damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
4933406M09Rik T A 1: 134,390,917 W476R probably damaging Het
Acsl3 G T 1: 78,688,286 R143L probably benign Het
Ankrd11 A T 8: 122,895,790 I420K probably benign Het
Cwh43 A G 5: 73,411,870 E85G probably benign Het
Dnah1 G T 14: 31,266,418 F3442L possibly damaging Het
Dock6 T A 9: 21,804,828 N1737I probably damaging Het
Fcf1 A G 12: 84,974,147 Y55C possibly damaging Het
Fer1l6 T A 15: 58,590,503 Y802* probably null Het
Fgf9 T G 14: 58,083,302 S10A probably damaging Het
Fhad1 A G 4: 141,955,306 I508T possibly damaging Het
Flnc T C 6: 29,461,202 V2692A probably damaging Het
Gm38119 G T 3: 92,738,073 H71Q unknown Het
Hcn1 A T 13: 117,602,852 H50L unknown Het
Helz2 T C 2: 181,236,396 T870A possibly damaging Het
Iqcf4 T C 9: 106,568,601 I116V probably benign Het
Lama5 T A 2: 180,192,492 I1383F probably benign Het
Lmo2 C T 2: 103,981,072 T150I probably damaging Het
Myh13 A G 11: 67,360,468 E1391G probably damaging Het
Mylk T A 16: 34,894,947 probably null Het
Nat10 A T 2: 103,730,267 V731D probably damaging Het
Ncapd2 A G 6: 125,168,700 V1328A probably benign Het
Nfu1 C A 6: 87,025,559 Q207K probably damaging Het
Nipsnap2 T A 5: 129,739,769 probably null Het
Npc1 T C 18: 12,191,789 K1216E possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Phf3 T C 1: 30,804,683 I1732V probably damaging Het
Rasgrp4 G T 7: 29,137,717 R67L probably benign Het
Slc30a2 T C 4: 134,345,978 I112T probably damaging Het
Slc35d2 A G 13: 64,120,605 I78T probably damaging Het
Slc9a4 T A 1: 40,619,117 M600K probably damaging Het
Slfn8 A G 11: 83,016,736 I327T probably benign Het
Tas2r118 A G 6: 23,969,471 I197T probably benign Het
Tex15 A G 8: 33,570,934 I405V possibly damaging Het
Thsd7b T C 1: 129,678,084 S521P probably benign Het
Trim36 A G 18: 46,169,340 L535P probably damaging Het
Trim63 A T 4: 134,316,531 I102F probably damaging Het
Wdr47 G A 3: 108,643,085 V809M probably damaging Het
Other mutations in Rubcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Rubcn APN 16 32824377 critical splice donor site probably null
IGL00777:Rubcn APN 16 32836563 missense probably damaging 0.98
IGL01402:Rubcn APN 16 32827296 missense probably damaging 1.00
IGL01404:Rubcn APN 16 32827296 missense probably damaging 1.00
IGL02255:Rubcn APN 16 32827345 missense probably benign 0.04
IGL03019:Rubcn APN 16 32826707 missense probably damaging 0.98
IGL03388:Rubcn APN 16 32841568 missense probably benign 0.02
R0254:Rubcn UTSW 16 32847946 missense probably benign 0.00
R0373:Rubcn UTSW 16 32835980 missense probably damaging 1.00
R0636:Rubcn UTSW 16 32828686 missense probably damaging 1.00
R0839:Rubcn UTSW 16 32827343 missense probably damaging 0.98
R0967:Rubcn UTSW 16 32825717 missense probably benign 0.00
R1711:Rubcn UTSW 16 32843101 missense probably damaging 1.00
R1819:Rubcn UTSW 16 32826914 missense possibly damaging 0.93
R1840:Rubcn UTSW 16 32826172 missense possibly damaging 0.83
R2511:Rubcn UTSW 16 32847254 missense probably damaging 1.00
R3932:Rubcn UTSW 16 32829259 splice site probably null
R3933:Rubcn UTSW 16 32829259 splice site probably null
R4384:Rubcn UTSW 16 32856902 missense probably damaging 0.96
R4788:Rubcn UTSW 16 32836408 critical splice donor site probably null
R4852:Rubcn UTSW 16 32843308 missense probably damaging 1.00
R4921:Rubcn UTSW 16 32847294 missense probably damaging 1.00
R4950:Rubcn UTSW 16 32843193 missense probably damaging 1.00
R5234:Rubcn UTSW 16 32836458 missense probably damaging 1.00
R5527:Rubcn UTSW 16 32826711 missense probably damaging 1.00
R5616:Rubcn UTSW 16 32826923 missense possibly damaging 0.76
R6970:Rubcn UTSW 16 32868144 intron probably benign
R7120:Rubcn UTSW 16 32836469 missense probably damaging 1.00
R7121:Rubcn UTSW 16 32836469 missense probably damaging 1.00
R7221:Rubcn UTSW 16 32866923 intron probably null
R7833:Rubcn UTSW 16 32868274 start gained probably benign
X0065:Rubcn UTSW 16 32847985 missense possibly damaging 0.85
Z1176:Rubcn UTSW 16 32843163 missense probably benign 0.00
Z1177:Rubcn UTSW 16 32825589 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCCAGGAGATGAGAAAGC -3'
(R):5'- GATATTACAGACCCGTGCTGC -3'

Sequencing Primer
(F):5'- CCTGAACCTGTAAGGCTGCTTG -3'
(R):5'- CTGGGTCCAGCCTTTGTTTC -3'
Posted On2016-12-20