Incidental Mutation 'R5824:Reg3b'
ID450065
Institutional Source Beutler Lab
Gene Symbol Reg3b
Ensembl Gene ENSMUSG00000071356
Gene Nameregenerating islet-derived 3 beta
SynonymsPap, PAP1, REG-III, RegIII (beta)
MMRRC Submission 043216-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5824 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location78370657-78373466 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78372121 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 77 (V77I)
Ref Sequence ENSEMBL: ENSMUSP00000145528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089667] [ENSMUST00000096904] [ENSMUST00000167492] [ENSMUST00000203266] [ENSMUST00000204873] [ENSMUST00000205240]
Predicted Effect probably benign
Transcript: ENSMUST00000089667
SMART Domains Protein: ENSMUSP00000087096
Gene: ENSMUSG00000068341

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 172 6.99e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096904
AA Change: V77I

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000094667
Gene: ENSMUSG00000071356
AA Change: V77I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 172 1.12e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167492
SMART Domains Protein: ENSMUSP00000132220
Gene: ENSMUSG00000068341

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 126 1.66e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000203266
AA Change: V77I

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000145528
Gene: ENSMUSG00000071356
AA Change: V77I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 143 5e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204760
Predicted Effect possibly damaging
Transcript: ENSMUST00000204873
AA Change: V77I

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145280
Gene: ENSMUSG00000071356
AA Change: V77I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 140 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205240
SMART Domains Protein: ENSMUSP00000144715
Gene: ENSMUSG00000068341

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 126 1.66e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pancreatic secretory protein that may be involved in cell proliferation or differentiation. It has similarity to the C-type lectin superfamily. The enhanced expression of this gene is observed during pancreatic inflammation and liver carcinogenesis. The mature protein also functions as an antimicrobial protein with antibacterial activity. Alternate splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Nov 2014]
PHENOTYPE: Male homozygous mice exhibit impaired glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A T 13: 59,466,099 H66Q probably damaging Het
Ap1g1 T A 8: 109,838,912 probably null Het
Ap4b1 A T 3: 103,813,385 I124F probably benign Het
Arhgap10 A T 8: 77,358,552 Y462* probably null Het
BC067074 T A 13: 113,368,620 H2094Q probably damaging Het
Btnl10 G T 11: 58,923,440 M315I probably benign Het
Cep295 A G 9: 15,325,656 V1994A possibly damaging Het
Cherp G A 8: 72,462,258 probably benign Het
Ckap5 G A 2: 91,559,136 A318T probably benign Het
Cma1 T C 14: 55,941,725 K238E possibly damaging Het
Ctif T C 18: 75,610,678 D141G possibly damaging Het
Ctnna1 T C 18: 35,179,886 S264P probably benign Het
Dnah12 G T 14: 26,770,518 probably null Het
Dnah5 A G 15: 28,313,821 T1928A probably benign Het
Etfdh G A 3: 79,609,945 P379L probably damaging Het
Gfra3 T C 18: 34,711,211 N92S probably damaging Het
Gm15448 T C 7: 3,824,754 T135A probably damaging Het
Gpr161 C A 1: 165,310,991 T382K possibly damaging Het
Gspt2 T C X: 94,636,465 V70A possibly damaging Het
Hmcn1 A G 1: 150,993,023 V10A probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kpna1 A G 16: 36,020,205 D205G possibly damaging Het
Man2a2 T G 7: 80,353,032 D1067A probably benign Het
Map3k4 G A 17: 12,229,639 H1551Y probably damaging Het
Moxd1 A T 10: 24,287,097 I486F probably damaging Het
Notch3 G T 17: 32,153,861 R579S possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Olfr808 T C 10: 129,768,381 V295A probably damaging Het
Olfr878 A G 9: 37,919,565 T308A probably benign Het
Recql4 C T 15: 76,708,585 C302Y probably damaging Het
Terb1 T C 8: 104,485,447 T301A probably benign Het
Tmem260 G A 14: 48,505,328 C540Y probably damaging Het
Tmprss15 A T 16: 79,034,313 F385I probably damaging Het
Trbv12-2 G A 6: 41,118,840 probably benign Het
Upk3bl T A 5: 136,060,279 Y196* probably null Het
Vmn1r199 A T 13: 22,383,578 K304N probably benign Het
Other mutations in Reg3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03143:Reg3b APN 6 78372200 nonsense probably null
R0017:Reg3b UTSW 6 78372861 missense possibly damaging 0.48
R0017:Reg3b UTSW 6 78372861 missense possibly damaging 0.48
R0413:Reg3b UTSW 6 78371841 missense probably damaging 1.00
R1321:Reg3b UTSW 6 78372953 unclassified probably null
R1794:Reg3b UTSW 6 78372214 unclassified probably null
R1960:Reg3b UTSW 6 78371814 missense probably damaging 0.98
R2513:Reg3b UTSW 6 78371819 missense probably benign 0.00
R3877:Reg3b UTSW 6 78371233 missense possibly damaging 0.65
R4033:Reg3b UTSW 6 78373209 missense possibly damaging 0.71
R4874:Reg3b UTSW 6 78372826 missense possibly damaging 0.53
R5118:Reg3b UTSW 6 78372128 missense probably damaging 1.00
R5301:Reg3b UTSW 6 78371260 missense probably damaging 0.96
R5344:Reg3b UTSW 6 78372860 missense probably benign 0.02
R5408:Reg3b UTSW 6 78373232 missense probably benign
R6643:Reg3b UTSW 6 78372922 missense possibly damaging 0.53
Z1176:Reg3b UTSW 6 78372828 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GGTTTGATGCAGAAGTAAGTGC -3'
(R):5'- TTTCCAGGTTCACTCTGGGG -3'

Sequencing Primer
(F):5'- TACACAAGGAACACACGGAAATG -3'
(R):5'- GGGACGCATAGATAATGTATTCCCC -3'
Posted On2016-12-20