Incidental Mutation 'R5824:Ap1g1'
ID450071
Institutional Source Beutler Lab
Gene Symbol Ap1g1
Ensembl Gene ENSMUSG00000031731
Gene Nameadaptor protein complex AP-1, gamma 1 subunit
SynonymsD8Ertd374e, Adtg, gamma-adaptin
MMRRC Submission 043216-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5824 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location109778554-109864204 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 109838912 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034171] [ENSMUST00000034171] [ENSMUST00000034171] [ENSMUST00000034171] [ENSMUST00000093157] [ENSMUST00000093157] [ENSMUST00000093157] [ENSMUST00000093157] [ENSMUST00000093157]
Predicted Effect probably null
Transcript: ENSMUST00000034171
SMART Domains Protein: ENSMUSP00000034171
Gene: ENSMUSG00000031731

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Adaptin_N 23 574 7.8e-157 PFAM
low complexity region 626 636 N/A INTRINSIC
low complexity region 653 667 N/A INTRINSIC
low complexity region 668 676 N/A INTRINSIC
Alpha_adaptinC2 699 817 6.37e-46 SMART
Predicted Effect probably null
Transcript: ENSMUST00000034171
SMART Domains Protein: ENSMUSP00000034171
Gene: ENSMUSG00000031731

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Adaptin_N 23 574 7.8e-157 PFAM
low complexity region 626 636 N/A INTRINSIC
low complexity region 653 667 N/A INTRINSIC
low complexity region 668 676 N/A INTRINSIC
Alpha_adaptinC2 699 817 6.37e-46 SMART
Predicted Effect probably null
Transcript: ENSMUST00000034171
SMART Domains Protein: ENSMUSP00000034171
Gene: ENSMUSG00000031731

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Adaptin_N 23 574 7.8e-157 PFAM
low complexity region 626 636 N/A INTRINSIC
low complexity region 653 667 N/A INTRINSIC
low complexity region 668 676 N/A INTRINSIC
Alpha_adaptinC2 699 817 6.37e-46 SMART
Predicted Effect probably null
Transcript: ENSMUST00000034171
SMART Domains Protein: ENSMUSP00000034171
Gene: ENSMUSG00000031731

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Adaptin_N 23 574 7.8e-157 PFAM
low complexity region 626 636 N/A INTRINSIC
low complexity region 653 667 N/A INTRINSIC
low complexity region 668 676 N/A INTRINSIC
Alpha_adaptinC2 699 817 6.37e-46 SMART
Predicted Effect probably null
Transcript: ENSMUST00000093157
SMART Domains Protein: ENSMUSP00000090844
Gene: ENSMUSG00000031731

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Adaptin_N 23 577 1.1e-155 PFAM
low complexity region 629 639 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
low complexity region 671 679 N/A INTRINSIC
Alpha_adaptinC2 702 820 6.37e-46 SMART
Predicted Effect probably null
Transcript: ENSMUST00000093157
SMART Domains Protein: ENSMUSP00000090844
Gene: ENSMUSG00000031731

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Adaptin_N 23 577 1.1e-155 PFAM
low complexity region 629 639 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
low complexity region 671 679 N/A INTRINSIC
Alpha_adaptinC2 702 820 6.37e-46 SMART
Predicted Effect probably null
Transcript: ENSMUST00000093157
SMART Domains Protein: ENSMUSP00000090844
Gene: ENSMUSG00000031731

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Adaptin_N 23 577 1.1e-155 PFAM
low complexity region 629 639 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
low complexity region 671 679 N/A INTRINSIC
Alpha_adaptinC2 702 820 6.37e-46 SMART
Predicted Effect probably null
Transcript: ENSMUST00000093157
SMART Domains Protein: ENSMUSP00000090844
Gene: ENSMUSG00000031731

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Adaptin_N 23 577 1.1e-155 PFAM
low complexity region 629 639 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
low complexity region 671 679 N/A INTRINSIC
Alpha_adaptinC2 702 820 6.37e-46 SMART
Predicted Effect probably null
Transcript: ENSMUST00000093157
SMART Domains Protein: ENSMUSP00000090844
Gene: ENSMUSG00000031731

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Adaptin_N 23 577 1.1e-155 PFAM
low complexity region 629 639 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
low complexity region 671 679 N/A INTRINSIC
Alpha_adaptinC2 702 820 6.37e-46 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172892
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptins are important components of clathrin-coated vesicles transporting ligand-receptor complexes from the plasma membrane or from the trans-Golgi network to lysosomes. The adaptin family of proteins is composed of four classes of molecules named alpha, beta-, beta prime- and gamma- adaptins. Adaptins, together with medium and small subunits, form a heterotetrameric complex called an adaptor, whose role is to promote the formation of clathrin-coated pits and vesicles. The protein encoded by this gene is a gamma-adaptin protein and it belongs to the adaptor complexes large subunits family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit complete embryonic lethality before implantation. Heterozygotes display slow postnatal weight gain, decreased CD4-positive, alpha beta T cell number in the thymus, and decreased body size up to 10 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A T 13: 59,466,099 H66Q probably damaging Het
Ap4b1 A T 3: 103,813,385 I124F probably benign Het
Arhgap10 A T 8: 77,358,552 Y462* probably null Het
BC067074 T A 13: 113,368,620 H2094Q probably damaging Het
Btnl10 G T 11: 58,923,440 M315I probably benign Het
Cep295 A G 9: 15,325,656 V1994A possibly damaging Het
Cherp G A 8: 72,462,258 probably benign Het
Ckap5 G A 2: 91,559,136 A318T probably benign Het
Cma1 T C 14: 55,941,725 K238E possibly damaging Het
Ctif T C 18: 75,610,678 D141G possibly damaging Het
Ctnna1 T C 18: 35,179,886 S264P probably benign Het
Dnah12 G T 14: 26,770,518 probably null Het
Dnah5 A G 15: 28,313,821 T1928A probably benign Het
Etfdh G A 3: 79,609,945 P379L probably damaging Het
Gfra3 T C 18: 34,711,211 N92S probably damaging Het
Gm15448 T C 7: 3,824,754 T135A probably damaging Het
Gpr161 C A 1: 165,310,991 T382K possibly damaging Het
Gspt2 T C X: 94,636,465 V70A possibly damaging Het
Hmcn1 A G 1: 150,993,023 V10A probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kpna1 A G 16: 36,020,205 D205G possibly damaging Het
Man2a2 T G 7: 80,353,032 D1067A probably benign Het
Map3k4 G A 17: 12,229,639 H1551Y probably damaging Het
Moxd1 A T 10: 24,287,097 I486F probably damaging Het
Notch3 G T 17: 32,153,861 R579S possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Olfr808 T C 10: 129,768,381 V295A probably damaging Het
Olfr878 A G 9: 37,919,565 T308A probably benign Het
Recql4 C T 15: 76,708,585 C302Y probably damaging Het
Reg3b G A 6: 78,372,121 V77I possibly damaging Het
Terb1 T C 8: 104,485,447 T301A probably benign Het
Tmem260 G A 14: 48,505,328 C540Y probably damaging Het
Tmprss15 A T 16: 79,034,313 F385I probably damaging Het
Trbv12-2 G A 6: 41,118,840 probably benign Het
Upk3bl T A 5: 136,060,279 Y196* probably null Het
Vmn1r199 A T 13: 22,383,578 K304N probably benign Het
Other mutations in Ap1g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Ap1g1 APN 8 109832782 missense possibly damaging 0.85
IGL01907:Ap1g1 APN 8 109843343 splice site probably benign
IGL02248:Ap1g1 APN 8 109863433 utr 3 prime probably benign
IGL02548:Ap1g1 APN 8 109849622 missense probably damaging 1.00
Collapse UTSW 8 109828336 critical splice donor site probably null
Deflate UTSW 8 109851132 critical splice donor site probably null
depress UTSW 8 109838920 missense probably damaging 1.00
R0158:Ap1g1 UTSW 8 109855635 missense probably benign 0.00
R0226:Ap1g1 UTSW 8 109855062 missense probably benign 0.39
R0254:Ap1g1 UTSW 8 109803117 missense probably benign 0.01
R0315:Ap1g1 UTSW 8 109819035 missense probably benign
R0380:Ap1g1 UTSW 8 109803164 splice site probably benign
R0471:Ap1g1 UTSW 8 109853643 missense possibly damaging 0.90
R0508:Ap1g1 UTSW 8 109837732 splice site probably benign
R0837:Ap1g1 UTSW 8 109851065 missense probably damaging 1.00
R1025:Ap1g1 UTSW 8 109818939 missense probably benign 0.24
R1700:Ap1g1 UTSW 8 109853612 missense probably damaging 1.00
R1759:Ap1g1 UTSW 8 109833221 missense probably damaging 1.00
R1809:Ap1g1 UTSW 8 109833182 splice site probably benign
R2161:Ap1g1 UTSW 8 109844354 missense probably damaging 1.00
R3428:Ap1g1 UTSW 8 109843448 missense probably damaging 1.00
R3772:Ap1g1 UTSW 8 109837786 missense probably damaging 1.00
R3897:Ap1g1 UTSW 8 109854999 missense probably damaging 0.97
R4244:Ap1g1 UTSW 8 109833490 missense probably benign 0.04
R4714:Ap1g1 UTSW 8 109829620 missense probably damaging 0.98
R4736:Ap1g1 UTSW 8 109855082 missense possibly damaging 0.93
R5173:Ap1g1 UTSW 8 109851132 critical splice donor site probably null
R5185:Ap1g1 UTSW 8 109863326 utr 3 prime probably benign
R5435:Ap1g1 UTSW 8 109838920 missense probably damaging 1.00
R5685:Ap1g1 UTSW 8 109837783 missense probably damaging 0.99
R5867:Ap1g1 UTSW 8 109818982 missense probably damaging 1.00
R6339:Ap1g1 UTSW 8 109844368 missense possibly damaging 0.85
R6978:Ap1g1 UTSW 8 109828336 critical splice donor site probably null
R7440:Ap1g1 UTSW 8 109802724 intron probably null
R7532:Ap1g1 UTSW 8 109860164 missense probably damaging 1.00
R7598:Ap1g1 UTSW 8 109849676 missense probably benign 0.01
R8022:Ap1g1 UTSW 8 109832735 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGTTCCAAAGACTCCCCACTTG -3'
(R):5'- TAGAGGACAGACACAGCCTTATC -3'

Sequencing Primer
(F):5'- GACTCCCCACTTGTCCCAACTG -3'
(R):5'- TCAAAAATCTGTTCCACTTACCAGG -3'
Posted On2016-12-20