Incidental Mutation 'R5824:Recql4'
ID450086
Institutional Source Beutler Lab
Gene Symbol Recql4
Ensembl Gene ENSMUSG00000033762
Gene NameRecQ protein-like 4
Synonyms
MMRRC Submission 043216-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5824 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76703553-76710548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76708585 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 302 (C302Y)
Ref Sequence ENSEMBL: ENSMUSP00000155694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019224] [ENSMUST00000036423] [ENSMUST00000036852] [ENSMUST00000127208] [ENSMUST00000136840] [ENSMUST00000137649] [ENSMUST00000142610] [ENSMUST00000155225] [ENSMUST00000155735] [ENSMUST00000230544] [ENSMUST00000230724]
Predicted Effect probably benign
Transcript: ENSMUST00000019224
SMART Domains Protein: ENSMUSP00000019224
Gene: ENSMUSG00000019080

DomainStartEndE-ValueType
Pfam:MFS_1 8 373 3e-16 PFAM
transmembrane domain 388 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036423
SMART Domains Protein: ENSMUSP00000049466
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000036852
AA Change: C395Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044363
Gene: ENSMUSG00000033762
AA Change: C395Y

DomainStartEndE-ValueType
Pfam:Drc1-Sld2 4 132 2.8e-14 PFAM
low complexity region 169 187 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
ZnF_C2HC 394 410 5.67e-5 SMART
DEXDc 494 701 5.86e-28 SMART
HELICc 736 831 1.48e-24 SMART
Blast:DEXDc 902 1117 3e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127208
SMART Domains Protein: ENSMUSP00000114921
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136840
SMART Domains Protein: ENSMUSP00000119670
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137649
SMART Domains Protein: ENSMUSP00000121982
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142506
Predicted Effect probably benign
Transcript: ENSMUST00000142610
SMART Domains Protein: ENSMUSP00000117780
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154531
Predicted Effect probably benign
Transcript: ENSMUST00000155225
Predicted Effect probably benign
Transcript: ENSMUST00000155735
SMART Domains Protein: ENSMUSP00000115446
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229360
Predicted Effect probably damaging
Transcript: ENSMUST00000230544
AA Change: C302Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000230724
Meta Mutation Damage Score 0.1377 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA helicase that belongs to the RecQ helicase family. DNA helicases unwind double-stranded DNA into single-stranded DNAs and may modulate chromosome segregation. This gene is predominantly expressed in thymus and testis. Mutations in this gene are associated with Rothmund-Thomson, RAPADILINO and Baller-Gerold syndromes. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous loss of exons 5-8 causes embryonic death. Deletion of exon 13 causes neo- and postnatal lethality, stunted growth, skin, hair and bone defects, tissue hypoplasia and tooth dysgenesis. Mice lacking exons 9-13 show palate and limb defects, aneuploidy, poikiloderma and cancer predisposition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A T 13: 59,466,099 H66Q probably damaging Het
Ap1g1 T A 8: 109,838,912 probably null Het
Ap4b1 A T 3: 103,813,385 I124F probably benign Het
Arhgap10 A T 8: 77,358,552 Y462* probably null Het
BC067074 T A 13: 113,368,620 H2094Q probably damaging Het
Btnl10 G T 11: 58,923,440 M315I probably benign Het
Cep295 A G 9: 15,325,656 V1994A possibly damaging Het
Cherp G A 8: 72,462,258 probably benign Het
Ckap5 G A 2: 91,559,136 A318T probably benign Het
Cma1 T C 14: 55,941,725 K238E possibly damaging Het
Ctif T C 18: 75,610,678 D141G possibly damaging Het
Ctnna1 T C 18: 35,179,886 S264P probably benign Het
Dnah12 G T 14: 26,770,518 probably null Het
Dnah5 A G 15: 28,313,821 T1928A probably benign Het
Etfdh G A 3: 79,609,945 P379L probably damaging Het
Gfra3 T C 18: 34,711,211 N92S probably damaging Het
Gm15448 T C 7: 3,824,754 T135A probably damaging Het
Gpr161 C A 1: 165,310,991 T382K possibly damaging Het
Gspt2 T C X: 94,636,465 V70A possibly damaging Het
Hmcn1 A G 1: 150,993,023 V10A probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kpna1 A G 16: 36,020,205 D205G possibly damaging Het
Man2a2 T G 7: 80,353,032 D1067A probably benign Het
Map3k4 G A 17: 12,229,639 H1551Y probably damaging Het
Moxd1 A T 10: 24,287,097 I486F probably damaging Het
Notch3 G T 17: 32,153,861 R579S possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Olfr808 T C 10: 129,768,381 V295A probably damaging Het
Olfr878 A G 9: 37,919,565 T308A probably benign Het
Reg3b G A 6: 78,372,121 V77I possibly damaging Het
Terb1 T C 8: 104,485,447 T301A probably benign Het
Tmem260 G A 14: 48,505,328 C540Y probably damaging Het
Tmprss15 A T 16: 79,034,313 F385I probably damaging Het
Trbv12-2 G A 6: 41,118,840 probably benign Het
Upk3bl T A 5: 136,060,279 Y196* probably null Het
Vmn1r199 A T 13: 22,383,578 K304N probably benign Het
Other mutations in Recql4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Recql4 APN 15 76707336 missense possibly damaging 0.52
IGL01287:Recql4 APN 15 76709912 splice site probably benign
IGL01470:Recql4 APN 15 76708944 missense probably benign 0.40
IGL01809:Recql4 APN 15 76708870 nonsense probably null
IGL02094:Recql4 APN 15 76709517 missense probably benign 0.01
IGL02303:Recql4 APN 15 76708571 missense possibly damaging 0.64
IGL02702:Recql4 APN 15 76707285 missense probably damaging 1.00
IGL03086:Recql4 APN 15 76706268 missense probably benign 0.30
IGL03162:Recql4 APN 15 76706096 splice site probably null
ANU74:Recql4 UTSW 15 76705757 missense possibly damaging 0.47
F5770:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
R0688:Recql4 UTSW 15 76709809 unclassified probably null
R1171:Recql4 UTSW 15 76704039 missense possibly damaging 0.94
R1348:Recql4 UTSW 15 76709211 missense probably benign 0.01
R1487:Recql4 UTSW 15 76708983 missense probably benign 0.11
R1547:Recql4 UTSW 15 76706311 missense probably damaging 0.99
R1917:Recql4 UTSW 15 76703837 nonsense probably null
R3813:Recql4 UTSW 15 76704494 missense possibly damaging 0.67
R4066:Recql4 UTSW 15 76705827 missense probably damaging 1.00
R4363:Recql4 UTSW 15 76706044 missense probably benign 0.07
R4387:Recql4 UTSW 15 76705958 missense probably benign 0.00
R4388:Recql4 UTSW 15 76705958 missense probably benign 0.00
R4700:Recql4 UTSW 15 76708585 missense probably damaging 1.00
R4701:Recql4 UTSW 15 76708585 missense probably damaging 1.00
R4923:Recql4 UTSW 15 76710181 missense probably damaging 1.00
R5075:Recql4 UTSW 15 76709544 missense probably damaging 1.00
R5103:Recql4 UTSW 15 76706756 missense probably damaging 1.00
R5226:Recql4 UTSW 15 76710129 missense probably benign
R5500:Recql4 UTSW 15 76705578 intron probably benign
R5547:Recql4 UTSW 15 76705794 nonsense probably null
R5976:Recql4 UTSW 15 76709424 missense probably benign 0.01
R6086:Recql4 UTSW 15 76704587 missense probably damaging 0.96
R6756:Recql4 UTSW 15 76704859 missense probably benign 0.00
R7075:Recql4 UTSW 15 76706424 missense possibly damaging 0.95
R7086:Recql4 UTSW 15 76705553 missense unknown
R7449:Recql4 UTSW 15 76705565 missense unknown
R7653:Recql4 UTSW 15 76703782 missense probably benign 0.01
V7580:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
V7581:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
V7583:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCCAAGGTGGAAATGGGCTG -3'
(R):5'- CGTAAGCAGGTGAGATGTGCTG -3'

Sequencing Primer
(F):5'- GAAATGGGCTGTTTGTCATCC -3'
(R):5'- TGGAACAGGCCAGCCTC -3'
Posted On2016-12-20