Incidental Mutation 'R5824:Ctnna1'
ID450094
Institutional Source Beutler Lab
Gene Symbol Ctnna1
Ensembl Gene ENSMUSG00000037815
Gene Namecatenin (cadherin associated protein), alpha 1
Synonymsalpha E catenin, alpha(E)-catenin, 2010010M04Rik, Catna1
MMRRC Submission 043216-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5824 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location35118888-35254773 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35179886 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 264 (S264P)
Ref Sequence ENSEMBL: ENSMUSP00000049007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042345]
PDB Structure
CRYSTAL STRUCTURE OF THE ALPHA-CATENIN DIMERIZATION DOMAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF A CHIMERA OF BETA-CATENIN AND ALPHA-CATENIN [X-RAY DIFFRACTION]
alpha-catenin fragment, residues 385-651 [X-RAY DIFFRACTION]
Alpha-E-catenin is an autoinhibited molecule that co-activates vinculin [X-RAY DIFFRACTION]
Alpha-E-catenin is an autoinhibited molecule that co-activates vinculin [X-RAY DIFFRACTION]
Crystal structure of full-length mouse alphaE-catenin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000042345
AA Change: S264P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049007
Gene: ENSMUSG00000037815
AA Change: S264P

DomainStartEndE-ValueType
Pfam:Vinculin 19 339 2.6e-99 PFAM
Pfam:Vinculin 333 867 3.3e-218 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the catenin family of proteins that play an important role in cell adhesion process by connecting cadherins located on the plasma membrane to the actin filaments inside the cell. The encoded mechanosensing protein contains three vinculin homology domains and undergoes conformational changes in response to cytoskeletal tension, resulting in the reconfiguration of cadherin-actin filament connections. Certain mutations in this gene cause butterfly-shaped pigment dystrophy. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at the blastocyst stage. A conditional knockout in surface epithelium results in defects in hair follicle development and epidermal morphogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A T 13: 59,466,099 H66Q probably damaging Het
Ap1g1 T A 8: 109,838,912 probably null Het
Ap4b1 A T 3: 103,813,385 I124F probably benign Het
Arhgap10 A T 8: 77,358,552 Y462* probably null Het
BC067074 T A 13: 113,368,620 H2094Q probably damaging Het
Btnl10 G T 11: 58,923,440 M315I probably benign Het
Cep295 A G 9: 15,325,656 V1994A possibly damaging Het
Cherp G A 8: 72,462,258 probably benign Het
Ckap5 G A 2: 91,559,136 A318T probably benign Het
Cma1 T C 14: 55,941,725 K238E possibly damaging Het
Ctif T C 18: 75,610,678 D141G possibly damaging Het
Dnah12 G T 14: 26,770,518 probably null Het
Dnah5 A G 15: 28,313,821 T1928A probably benign Het
Etfdh G A 3: 79,609,945 P379L probably damaging Het
Gfra3 T C 18: 34,711,211 N92S probably damaging Het
Gm15448 T C 7: 3,824,754 T135A probably damaging Het
Gpr161 C A 1: 165,310,991 T382K possibly damaging Het
Gspt2 T C X: 94,636,465 V70A possibly damaging Het
Hmcn1 A G 1: 150,993,023 V10A probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kpna1 A G 16: 36,020,205 D205G possibly damaging Het
Man2a2 T G 7: 80,353,032 D1067A probably benign Het
Map3k4 G A 17: 12,229,639 H1551Y probably damaging Het
Moxd1 A T 10: 24,287,097 I486F probably damaging Het
Notch3 G T 17: 32,153,861 R579S possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Olfr808 T C 10: 129,768,381 V295A probably damaging Het
Olfr878 A G 9: 37,919,565 T308A probably benign Het
Recql4 C T 15: 76,708,585 C302Y probably damaging Het
Reg3b G A 6: 78,372,121 V77I possibly damaging Het
Terb1 T C 8: 104,485,447 T301A probably benign Het
Tmem260 G A 14: 48,505,328 C540Y probably damaging Het
Tmprss15 A T 16: 79,034,313 F385I probably damaging Het
Trbv12-2 G A 6: 41,118,840 probably benign Het
Upk3bl T A 5: 136,060,279 Y196* probably null Het
Vmn1r199 A T 13: 22,383,578 K304N probably benign Het
Other mutations in Ctnna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Ctnna1 APN 18 35223448 missense probably damaging 0.97
IGL03068:Ctnna1 APN 18 35249732 missense possibly damaging 0.66
IGL03286:Ctnna1 APN 18 35175153 missense probably benign 0.37
PIT4458001:Ctnna1 UTSW 18 35175126 missense possibly damaging 0.65
R0282:Ctnna1 UTSW 18 35244122 missense possibly damaging 0.79
R1971:Ctnna1 UTSW 18 35154527 missense probably benign
R2117:Ctnna1 UTSW 18 35152625 missense possibly damaging 0.76
R2424:Ctnna1 UTSW 18 35253707 missense probably benign 0.00
R4602:Ctnna1 UTSW 18 35179827 missense possibly damaging 0.92
R4812:Ctnna1 UTSW 18 35239477 missense probably damaging 1.00
R5120:Ctnna1 UTSW 18 35182554 critical splice donor site probably null
R5469:Ctnna1 UTSW 18 35239520 missense probably benign 0.00
R5607:Ctnna1 UTSW 18 35249742 missense probably benign 0.25
R5629:Ctnna1 UTSW 18 35249749 missense probably benign
R5971:Ctnna1 UTSW 18 35154514 missense probably benign
R6191:Ctnna1 UTSW 18 35174355 missense probably damaging 1.00
R7065:Ctnna1 UTSW 18 35152616 missense probably benign
R7519:Ctnna1 UTSW 18 35174371 missense probably benign 0.02
R7624:Ctnna1 UTSW 18 35244844 missense probably benign 0.00
R7636:Ctnna1 UTSW 18 35223473 missense possibly damaging 0.92
U15987:Ctnna1 UTSW 18 35154514 missense probably benign
X0021:Ctnna1 UTSW 18 35182545 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTACGTTAATGCAGTTGTGTC -3'
(R):5'- AAAATGGGCTTTCATCACAAGC -3'

Sequencing Primer
(F):5'- CAATCGTGATCAGATGGCTGC -3'
(R):5'- GGGCTTTCATCACAAGCCTTGATC -3'
Posted On2016-12-20