Incidental Mutation 'R5825:Il18rap'
ID 450097
Institutional Source Beutler Lab
Gene Symbol Il18rap
Ensembl Gene ENSMUSG00000026068
Gene Name interleukin 18 receptor accessory protein
Synonyms AcPL accessory protein-like)
MMRRC Submission 044053-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5825 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 40515362-40551705 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40531566 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 223 (T223A)
Ref Sequence ENSEMBL: ENSMUSP00000027237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027237]
AlphaFold Q9Z2B1
Predicted Effect probably benign
Transcript: ENSMUST00000027237
AA Change: T223A

PolyPhen 2 Score 0.379 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027237
Gene: ENSMUSG00000026068
AA Change: T223A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:IG_like 31 144 2e-36 BLAST
IG 159 240 2.94e0 SMART
IG 257 354 1.35e0 SMART
transmembrane domain 363 385 N/A INTRINSIC
TIR 406 561 3.68e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163057
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 95.3%
  • 20x: 83.6%
Validation Efficiency
MGI Phenotype FUNCTION: Interleukin-18 (or interferon-gamma inducing factor) is a proinflammatory cytokine that induces cell-mediated immunity following microbial infection. This gene encodes a member of the interleukin-1 receptor family. The encoded protein is an accessory subunit of the receptor for interleukin-18 and mediates signaling through this cytokine. Mice lacking this gene exhibit a defective cell-mediated immune response. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice exhibit defective IL-18-mediated immune responses such as the inability of splenocytes, T helper 1 cells and neutrophils to produce cytokines in response to IL-18. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A T 15: 60,920,127 Y217* probably null Het
Abca2 A T 2: 25,436,736 I567F probably benign Het
Acss2 T A 2: 155,549,178 probably null Het
Atxn7l2 C A 3: 108,204,811 A320S probably damaging Het
Bfsp1 C T 2: 143,827,459 G400D probably benign Het
Ces5a G T 8: 93,525,667 A199D probably damaging Het
Chd2 A T 7: 73,484,602 probably null Het
Crebbp A G 16: 4,087,742 V1705A probably damaging Het
Cyp2j8 T A 4: 96,507,214 Q58L probably benign Het
Dlec1 T A 9: 119,142,968 I1379N probably damaging Het
Dnah9 T C 11: 66,126,601 H593R probably benign Het
Ep300 T A 15: 81,611,472 C412S probably benign Het
Fam110a A G 2: 151,970,041 S270P probably damaging Het
Gcc2 A G 10: 58,294,821 T1412A probably damaging Het
Gm4788 T A 1: 139,774,598 probably null Het
Helz2 T C 2: 181,232,656 E2015G probably benign Het
Hormad1 T C 3: 95,562,559 V39A probably damaging Het
Igf2 G T 7: 142,653,855 H168Q probably damaging Het
Itpr2 T C 6: 146,144,149 E2573G probably damaging Het
Jcad T A 18: 4,674,896 V886E probably benign Het
Klra1 T C 6: 130,380,629 R12G probably damaging Het
Lamb1 A G 12: 31,318,614 I1248V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk7 C T 11: 61,490,381 R465Q possibly damaging Het
Mogs T C 6: 83,118,212 V670A possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Ninl A T 2: 150,940,724 I1182N probably damaging Het
Nup160 A G 2: 90,679,770 probably null Het
Nynrin A G 14: 55,864,226 R451G probably benign Het
Olfr1126 A G 2: 87,457,450 D95G probably benign Het
Olfr190 T C 16: 59,074,661 I140V probably benign Het
Osbp A G 19: 11,970,721 T131A probably damaging Het
Pcdhga12 A C 18: 37,768,503 D796A possibly damaging Het
Pcdhgb8 G A 18: 37,762,236 V120I probably benign Het
Pdgfb A T 15: 79,997,668 V213E probably benign Het
Phldb2 T C 16: 45,763,097 M1013V probably benign Het
Pnmal1 A G 7: 16,961,095 S292G probably benign Het
Prrt4 A G 6: 29,177,183 S196P probably benign Het
Rap1gds1 T C 3: 138,955,375 M463V possibly damaging Het
Tmprss11g A T 5: 86,498,533 S58R probably damaging Het
Traf3 C A 12: 111,255,361 Q319K probably benign Het
Trappc8 C T 18: 20,873,920 V194M probably damaging Het
Tyw1 A G 5: 130,268,088 K182R probably damaging Het
Usp48 A G 4: 137,623,378 T585A probably benign Het
Xkr6 G T 14: 63,819,032 V387L probably benign Het
Yod1 T C 1: 130,719,006 W207R probably damaging Het
Zdhhc8 T C 16: 18,228,674 S63G probably null Het
Zfp827 A G 8: 79,179,016 E874G probably damaging Het
Zfy1 T A Y: 726,531 K411N possibly damaging Het
Other mutations in Il18rap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Il18rap APN 1 40541921 missense probably benign 0.03
IGL01467:Il18rap APN 1 40548639 missense probably damaging 1.00
IGL01505:Il18rap APN 1 40537084 missense probably damaging 0.97
IGL02215:Il18rap APN 1 40547922 missense probably damaging 1.00
IGL03307:Il18rap APN 1 40543067 missense probably benign 0.01
BB006:Il18rap UTSW 1 40531580 missense probably damaging 1.00
BB007:Il18rap UTSW 1 40548643 missense probably damaging 0.99
BB016:Il18rap UTSW 1 40531580 missense probably damaging 1.00
BB017:Il18rap UTSW 1 40548643 missense probably damaging 0.99
R0136:Il18rap UTSW 1 40525058 missense probably benign 0.04
R0299:Il18rap UTSW 1 40525058 missense probably benign 0.04
R0358:Il18rap UTSW 1 40549042 missense possibly damaging 0.53
R0499:Il18rap UTSW 1 40525058 missense probably benign 0.04
R0830:Il18rap UTSW 1 40542990 missense probably damaging 1.00
R1386:Il18rap UTSW 1 40531522 missense probably benign 0.00
R1817:Il18rap UTSW 1 40531527 missense probably benign 0.04
R1818:Il18rap UTSW 1 40531527 missense probably benign 0.04
R1819:Il18rap UTSW 1 40531527 missense probably benign 0.04
R3721:Il18rap UTSW 1 40537088 missense probably damaging 1.00
R5634:Il18rap UTSW 1 40539376 intron probably benign
R5663:Il18rap UTSW 1 40531557 missense probably damaging 1.00
R5690:Il18rap UTSW 1 40537112 missense possibly damaging 0.73
R6140:Il18rap UTSW 1 40525052 missense probably benign 0.04
R6291:Il18rap UTSW 1 40524889 missense probably benign 0.00
R6859:Il18rap UTSW 1 40525095 nonsense probably null
R6992:Il18rap UTSW 1 40542035 missense probably benign 0.00
R7317:Il18rap UTSW 1 40525376 missense probably damaging 0.98
R7402:Il18rap UTSW 1 40524951 missense probably benign 0.01
R7465:Il18rap UTSW 1 40543089 missense probably damaging 1.00
R7561:Il18rap UTSW 1 40524377 missense probably benign 0.00
R7929:Il18rap UTSW 1 40531580 missense probably damaging 1.00
R7930:Il18rap UTSW 1 40548643 missense probably damaging 0.99
R8151:Il18rap UTSW 1 40525268 missense probably benign 0.00
R8201:Il18rap UTSW 1 40539269 missense possibly damaging 0.75
R8356:Il18rap UTSW 1 40524924 missense probably benign 0.28
R8701:Il18rap UTSW 1 40539341 missense probably benign 0.01
R8870:Il18rap UTSW 1 40525120 splice site probably benign
R8874:Il18rap UTSW 1 40525346 missense probably damaging 1.00
R8911:Il18rap UTSW 1 40543017 missense probably benign 0.43
R8912:Il18rap UTSW 1 40543017 missense probably benign 0.43
R8913:Il18rap UTSW 1 40543017 missense probably benign 0.43
R8914:Il18rap UTSW 1 40543017 missense probably benign 0.43
R8958:Il18rap UTSW 1 40543017 missense probably benign 0.43
R8959:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9024:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9135:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9136:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9137:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9138:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9194:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9197:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9198:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9200:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9201:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9218:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9353:Il18rap UTSW 1 40547928 missense probably benign 0.02
R9465:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9466:Il18rap UTSW 1 40543017 missense probably benign 0.43
R9535:Il18rap UTSW 1 40547830 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGACCAGATCAGTCCATGAG -3'
(R):5'- CACTTTAATGGTTGCCGGTG -3'

Sequencing Primer
(F):5'- TCACATGAACGATTCTAAGAGACATC -3'
(R):5'- CCGGTGTGTGGCTATCTC -3'
Posted On 2016-12-20