Mutagenetix > Incidental Mutations

Incidental Mutation 'R5825:Lgr6'

450101

Institutional Source

Beutler Lab

Gene Symbol

Lgr6

Ensembl Gene

ENSMUSG00000042793

Gene Name

leucine-rich repeat-containing G protein-coupled receptor 6

Synonyms

A530037C04Rik

MMRRC Submission

044053-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5825 (G1)

Quality Score

134

Status

Not validated

Chromosome

Chromosomal Location

134983301-135105276 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 134994010 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 199 (A199T)

Ref Sequence

ENSEMBL: ENSMUSP00000122334 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044828] [ENSMUST00000137968]

Predicted Effect

probably damaging
Transcript: ENSMUST00000044828
AA Change: A476T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035444
Gene: ENSMUSG00000042793
AA Change: A476T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
LRRNT	34	70	5.19e-3	SMART
LRR	64	88	1.03e1	SMART
LRR_TYP	89	112	6.52e-5	SMART
LRR_TYP	113	136	2.71e-2	SMART
LRR_TYP	137	160	4.79e-3	SMART
LRR_TYP	161	184	1.58e-3	SMART
LRR_TYP	185	208	2.36e-2	SMART
LRR_TYP	209	232	3.39e-3	SMART
LRR	233	255	8.97e0	SMART
LRR_TYP	256	279	1.36e-2	SMART
Blast:LRR	281	303	6e-7	BLAST
LRR	327	350	9.24e1	SMART
LRR	351	373	1.41e0	SMART
LRR	374	396	4.84e1	SMART
LRR_TYP	397	420	4.54e-4	SMART
LRR_TYP	421	444	7.15e-2	SMART
transmembrane domain	568	590	N/A	INTRINSIC
transmembrane domain	599	621	N/A	INTRINSIC
transmembrane domain	643	665	N/A	INTRINSIC
transmembrane domain	686	708	N/A	INTRINSIC
transmembrane domain	728	750	N/A	INTRINSIC
transmembrane domain	776	798	N/A	INTRINSIC
transmembrane domain	808	830	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000137968
AA Change: A199T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122334
Gene: ENSMUSG00000042793
AA Change: A199T

Domain	Start	End	E-Value	Type
Blast:LRR	4	26	2e-7	BLAST
LRR	50	73	9.24e1	SMART
LRR	74	96	1.41e0	SMART
LRR	97	119	4.84e1	SMART
LRR_TYP	120	143	4.54e-4	SMART
LRR_TYP	144	167	7.15e-2	SMART
Pfam:7tm_1	301	550	3.6e-9	PFAM

Meta Mutation Damage Score

0.1650

Coding Region Coverage

1x: 99.8%
3x: 99.1%
10x: 95.3%
20x: 83.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane protein superfamily. The encoded protein is a glycoprotein hormone receptor with a large N-terminal extracellular domain that contains leucine-rich repeats important for the formation of a horseshoe-shaped interaction motif for ligand binding. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter/null allele are viable and fertile with no apparent abnormal phenotype. Similarly, mice homozygous for a knock-in allele are healthy and fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	A	T	15: 60,920,127	Y217*	probably null	Het
Abca2	A	T	2: 25,436,736	I567F	probably benign	Het
Acss2	T	A	2: 155,549,178		probably null	Het
Atxn7l2	C	A	3: 108,204,811	A320S	probably damaging	Het
Bfsp1	C	T	2: 143,827,459	G400D	probably benign	Het
Ces5a	G	T	8: 93,525,667	A199D	probably damaging	Het
Chd2	A	T	7: 73,484,602		probably null	Het
Crebbp	A	G	16: 4,087,742	V1705A	probably damaging	Het
Cyp2j8	T	A	4: 96,507,214	Q58L	probably benign	Het
Dlec1	T	A	9: 119,142,968	I1379N	probably damaging	Het
Dnah9	T	C	11: 66,126,601	H593R	probably benign	Het
Ep300	T	A	15: 81,611,472	C412S	probably benign	Het
Fam110a	A	G	2: 151,970,041	S270P	probably damaging	Het
Gcc2	A	G	10: 58,294,821	T1412A	probably damaging	Het
Gm4788	T	A	1: 139,774,598		probably null	Het
Helz2	T	C	2: 181,232,656	E2015G	probably benign	Het
Hormad1	T	C	3: 95,562,559	V39A	probably damaging	Het
Igf2	G	T	7: 142,653,855	H168Q	probably damaging	Het
Il18rap	A	G	1: 40,531,566	T223A	probably benign	Het
Itpr2	T	C	6: 146,144,149	E2573G	probably damaging	Het
Jcad	T	A	18: 4,674,896	V886E	probably benign	Het
Klra1	T	C	6: 130,380,629	R12G	probably damaging	Het
Lamb1	A	G	12: 31,318,614	I1248V	probably benign	Het
Mapk7	C	T	11: 61,490,381	R465Q	possibly damaging	Het
Mogs	T	C	6: 83,118,212	V670A	possibly damaging	Het
Mroh2a	C	T	1: 88,230,680	R150*	probably null	Het
Ninl	A	T	2: 150,940,724	I1182N	probably damaging	Het
Nup160	A	G	2: 90,679,770		probably null	Het
Nynrin	A	G	14: 55,864,226	R451G	probably benign	Het
Olfr1126	A	G	2: 87,457,450	D95G	probably benign	Het
Olfr190	T	C	16: 59,074,661	I140V	probably benign	Het
Osbp	A	G	19: 11,970,721	T131A	probably damaging	Het
Pcdhga12	A	C	18: 37,768,503	D796A	possibly damaging	Het
Pcdhgb8	G	A	18: 37,762,236	V120I	probably benign	Het
Pdgfb	A	T	15: 79,997,668	V213E	probably benign	Het
Phldb2	T	C	16: 45,763,097	M1013V	probably benign	Het
Pnmal1	A	G	7: 16,961,095	S292G	probably benign	Het
Prrt4	A	G	6: 29,177,183	S196P	probably benign	Het
Rap1gds1	T	C	3: 138,955,375	M463V	possibly damaging	Het
Tmprss11g	A	T	5: 86,498,533	S58R	probably damaging	Het
Traf3	C	A	12: 111,255,361	Q319K	probably benign	Het
Trappc8	C	T	18: 20,873,920	V194M	probably damaging	Het
Tyw1	A	G	5: 130,268,088	K182R	probably damaging	Het
Usp48	A	G	4: 137,623,378	T585A	probably benign	Het
Xkr6	G	T	14: 63,819,032	V387L	probably benign	Het
Yod1	T	C	1: 130,719,006	W207R	probably damaging	Het
Zdhhc8	T	C	16: 18,228,674	S63G	probably null	Het
Zfp827	A	G	8: 79,179,016	E874G	probably damaging	Het
Zfy1	T	A	Y: 726,531	K411N	possibly damaging	Het

Other mutations in Lgr6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02481:Lgr6	APN	1	135001691	splice site	probably benign
IGL02483:Lgr6	APN	1	135001691	splice site	probably benign
IGL03270:Lgr6	APN	1	134997704	missense	probably damaging	1.00
R0002:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0294:Lgr6	UTSW	1	134987891	missense	probably damaging	0.99
R0294:Lgr6	UTSW	1	135105061	missense	unknown
R0361:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0390:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0731:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0734:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0741:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0742:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0765:Lgr6	UTSW	1	134993886	missense	probably benign	0.04
R0903:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0904:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0905:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0906:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0907:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0908:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0967:Lgr6	UTSW	1	134994012	missense	probably damaging	1.00
R1078:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R1079:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R1131:Lgr6	UTSW	1	134987304	missense	probably damaging	0.98
R1440:Lgr6	UTSW	1	134987472	missense	probably damaging	1.00
R1533:Lgr6	UTSW	1	135104932	missense	possibly damaging	0.66
R1728:Lgr6	UTSW	1	134987088	missense	probably benign	0.00
R1728:Lgr6	UTSW	1	134990635	missense	probably benign	0.18
R1728:Lgr6	UTSW	1	135003476	missense	probably benign
R1729:Lgr6	UTSW	1	134987088	missense	probably benign	0.00
R1729:Lgr6	UTSW	1	134988009	missense	probably benign
R1729:Lgr6	UTSW	1	134990635	missense	probably benign	0.18
R1729:Lgr6	UTSW	1	135003476	missense	probably benign
R1730:Lgr6	UTSW	1	134987088	missense	probably benign	0.00
R1730:Lgr6	UTSW	1	134988009	missense	probably benign
R1730:Lgr6	UTSW	1	134990635	missense	probably benign	0.18
R1730:Lgr6	UTSW	1	135003476	missense	probably benign
R1739:Lgr6	UTSW	1	134987088	missense	probably benign	0.00
R1739:Lgr6	UTSW	1	134988009	missense	probably benign
R1739:Lgr6	UTSW	1	134990635	missense	probably benign	0.18
R1739:Lgr6	UTSW	1	135003476	missense	probably benign
R1762:Lgr6	UTSW	1	134987088	missense	probably benign	0.00
R1762:Lgr6	UTSW	1	134988009	missense	probably benign
R1762:Lgr6	UTSW	1	134990635	missense	probably benign	0.18
R1762:Lgr6	UTSW	1	135003476	missense	probably benign
R1782:Lgr6	UTSW	1	134987979	missense	probably damaging	0.98
R1783:Lgr6	UTSW	1	134987088	missense	probably benign	0.00
R1783:Lgr6	UTSW	1	134988009	missense	probably benign
R1783:Lgr6	UTSW	1	134990635	missense	probably benign	0.18
R1783:Lgr6	UTSW	1	135003476	missense	probably benign
R1784:Lgr6	UTSW	1	134987088	missense	probably benign	0.00
R1784:Lgr6	UTSW	1	134988009	missense	probably benign
R1784:Lgr6	UTSW	1	134990635	missense	probably benign	0.18
R1784:Lgr6	UTSW	1	135003476	missense	probably benign
R1785:Lgr6	UTSW	1	134987088	missense	probably benign	0.00
R1785:Lgr6	UTSW	1	134988009	missense	probably benign
R1785:Lgr6	UTSW	1	134990635	missense	probably benign	0.18
R1785:Lgr6	UTSW	1	135003476	missense	probably benign
R2020:Lgr6	UTSW	1	135075275	missense	probably damaging	1.00
R3104:Lgr6	UTSW	1	135000472	splice site	probably null
R4629:Lgr6	UTSW	1	135104932	missense	probably damaging	0.99
R4792:Lgr6	UTSW	1	135021806	missense	probably benign	0.03
R5001:Lgr6	UTSW	1	134990632	missense	probably benign	0.01
R5191:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5194:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5195:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5196:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5197:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5228:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5230:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5243:Lgr6	UTSW	1	135109272	unclassified	probably benign
R5299:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5300:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5417:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5419:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5601:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5603:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5636:Lgr6	UTSW	1	134987078	missense	probably benign	0.28
R5699:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5748:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5767:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5971:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R6078:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R6079:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R6138:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R6258:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R6259:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R6260:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R6740:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R6871:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R6984:Lgr6	UTSW	1	134988002	missense	possibly damaging	0.54
R6986:Lgr6	UTSW	1	134993956	missense	possibly damaging	0.80
R7233:Lgr6	UTSW	1	135000476	critical splice donor site	probably null
R7699:Lgr6	UTSW	1	134996032	missense	probably damaging	1.00
R7700:Lgr6	UTSW	1	134996032	missense	probably damaging	1.00
R7734:Lgr6	UTSW	1	135003243	missense	probably damaging	1.00
Z1088:Lgr6	UTSW	1	134988071	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- ACTTCCTTCGGGGTCACAAG -3'
(R):5'- GGTCAGGAATCAGGCTTCAAG -3'

Sequencing Primer
(F):5'- GTCACAAGGATCCCTACTAATACTTC -3'
(R):5'- GTCAGGAATCAGGCTTCAAGATTCC -3'

Posted On

2016-12-20