Incidental Mutation 'R5825:Atxn7l2'
ID450114
Institutional Source Beutler Lab
Gene Symbol Atxn7l2
Ensembl Gene ENSMUSG00000048997
Gene Nameataxin 7-like 2
Synonyms
MMRRC Submission 044053-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R5825 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location108202222-108210934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108204811 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 320 (A320S)
Ref Sequence ENSEMBL: ENSMUSP00000113020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065664] [ENSMUST00000102633] [ENSMUST00000106654] [ENSMUST00000106655] [ENSMUST00000117409] [ENSMUST00000117784] [ENSMUST00000119650] [ENSMUST00000127157]
Predicted Effect probably benign
Transcript: ENSMUST00000065664
SMART Domains Protein: ENSMUSP00000070361
Gene: ENSMUSG00000048796

DomainStartEndE-ValueType
B561 1 127 5.49e-40 SMART
transmembrane domain 138 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102633
AA Change: A355S

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099693
Gene: ENSMUSG00000048997
AA Change: A355S

DomainStartEndE-ValueType
low complexity region 55 63 N/A INTRINSIC
Pfam:SCA7 198 265 3.9e-29 PFAM
low complexity region 333 352 N/A INTRINSIC
low complexity region 356 363 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
low complexity region 515 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106654
SMART Domains Protein: ENSMUSP00000102265
Gene: ENSMUSG00000048796

DomainStartEndE-ValueType
B561 1 127 5.49e-40 SMART
transmembrane domain 138 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106655
SMART Domains Protein: ENSMUSP00000102266
Gene: ENSMUSG00000048796

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
B561 54 185 4.96e-47 SMART
transmembrane domain 196 218 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117409
AA Change: A323S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112976
Gene: ENSMUSG00000048997
AA Change: A323S

DomainStartEndE-ValueType
low complexity region 55 63 N/A INTRINSIC
Pfam:SCA7 164 235 1.2e-31 PFAM
low complexity region 301 320 N/A INTRINSIC
low complexity region 324 331 N/A INTRINSIC
low complexity region 403 420 N/A INTRINSIC
low complexity region 483 500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117784
AA Change: A355S

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114031
Gene: ENSMUSG00000048997
AA Change: A355S

DomainStartEndE-ValueType
low complexity region 55 63 N/A INTRINSIC
Pfam:SCA7 196 267 1.6e-31 PFAM
low complexity region 333 352 N/A INTRINSIC
low complexity region 356 363 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
low complexity region 515 532 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119650
AA Change: A320S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113020
Gene: ENSMUSG00000048997
AA Change: A320S

DomainStartEndE-ValueType
low complexity region 20 28 N/A INTRINSIC
Pfam:SCA7 161 232 1.2e-31 PFAM
low complexity region 298 317 N/A INTRINSIC
low complexity region 321 328 N/A INTRINSIC
low complexity region 400 417 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127157
SMART Domains Protein: ENSMUSP00000119223
Gene: ENSMUSG00000048997

DomainStartEndE-ValueType
Blast:ZnF_C2H2 23 45 1e-5 BLAST
low complexity region 55 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196823
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 95.3%
  • 20x: 83.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A T 15: 60,920,127 Y217* probably null Het
Abca2 A T 2: 25,436,736 I567F probably benign Het
Acss2 T A 2: 155,549,178 probably null Het
Bfsp1 C T 2: 143,827,459 G400D probably benign Het
Ces5a G T 8: 93,525,667 A199D probably damaging Het
Chd2 A T 7: 73,484,602 probably null Het
Crebbp A G 16: 4,087,742 V1705A probably damaging Het
Cyp2j8 T A 4: 96,507,214 Q58L probably benign Het
Dlec1 T A 9: 119,142,968 I1379N probably damaging Het
Dnah9 T C 11: 66,126,601 H593R probably benign Het
Ep300 T A 15: 81,611,472 C412S probably benign Het
Fam110a A G 2: 151,970,041 S270P probably damaging Het
Gcc2 A G 10: 58,294,821 T1412A probably damaging Het
Gm4788 T A 1: 139,774,598 probably null Het
Helz2 T C 2: 181,232,656 E2015G probably benign Het
Hormad1 T C 3: 95,562,559 V39A probably damaging Het
Igf2 G T 7: 142,653,855 H168Q probably damaging Het
Il18rap A G 1: 40,531,566 T223A probably benign Het
Itpr2 T C 6: 146,144,149 E2573G probably damaging Het
Jcad T A 18: 4,674,896 V886E probably benign Het
Klra1 T C 6: 130,380,629 R12G probably damaging Het
Lamb1 A G 12: 31,318,614 I1248V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk7 C T 11: 61,490,381 R465Q possibly damaging Het
Mogs T C 6: 83,118,212 V670A possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Ninl A T 2: 150,940,724 I1182N probably damaging Het
Nup160 A G 2: 90,679,770 probably null Het
Nynrin A G 14: 55,864,226 R451G probably benign Het
Olfr1126 A G 2: 87,457,450 D95G probably benign Het
Olfr190 T C 16: 59,074,661 I140V probably benign Het
Osbp A G 19: 11,970,721 T131A probably damaging Het
Pcdhga12 A C 18: 37,768,503 D796A possibly damaging Het
Pcdhgb8 G A 18: 37,762,236 V120I probably benign Het
Pdgfb A T 15: 79,997,668 V213E probably benign Het
Phldb2 T C 16: 45,763,097 M1013V probably benign Het
Pnmal1 A G 7: 16,961,095 S292G probably benign Het
Prrt4 A G 6: 29,177,183 S196P probably benign Het
Rap1gds1 T C 3: 138,955,375 M463V possibly damaging Het
Tmprss11g A T 5: 86,498,533 S58R probably damaging Het
Traf3 C A 12: 111,255,361 Q319K probably benign Het
Trappc8 C T 18: 20,873,920 V194M probably damaging Het
Tyw1 A G 5: 130,268,088 K182R probably damaging Het
Usp48 A G 4: 137,623,378 T585A probably benign Het
Xkr6 G T 14: 63,819,032 V387L probably benign Het
Yod1 T C 1: 130,719,006 W207R probably damaging Het
Zdhhc8 T C 16: 18,228,674 S63G probably null Het
Zfp827 A G 8: 79,179,016 E874G probably damaging Het
Zfy1 T A Y: 726,531 K411N possibly damaging Het
Other mutations in Atxn7l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Atxn7l2 APN 3 108203543 missense probably damaging 1.00
IGL02381:Atxn7l2 APN 3 108204495 unclassified probably benign
IGL03179:Atxn7l2 APN 3 108203647 nonsense probably null
R0610:Atxn7l2 UTSW 3 108204774 missense possibly damaging 0.80
R1454:Atxn7l2 UTSW 3 108208432 unclassified probably benign
R2474:Atxn7l2 UTSW 3 108203977 missense probably damaging 0.96
R4319:Atxn7l2 UTSW 3 108205832 missense probably damaging 1.00
R4322:Atxn7l2 UTSW 3 108205832 missense probably damaging 1.00
R4324:Atxn7l2 UTSW 3 108205832 missense probably damaging 1.00
R4797:Atxn7l2 UTSW 3 108204550 missense probably damaging 1.00
R5916:Atxn7l2 UTSW 3 108205662 splice site probably null
R7706:Atxn7l2 UTSW 3 108207403 missense probably damaging 0.98
R8109:Atxn7l2 UTSW 3 108203301 missense probably damaging 1.00
R8470:Atxn7l2 UTSW 3 108206969 missense probably benign 0.00
R8768:Atxn7l2 UTSW 3 108206934 missense probably benign 0.00
Z1176:Atxn7l2 UTSW 3 108205666 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACATAGCATCCTGGGCTCAC -3'
(R):5'- CTGTTTGAGAGAGCTCGGAC -3'

Sequencing Primer
(F):5'- GCTTCCAAATGTGCAAAACTGG -3'
(R):5'- AGAGAGCTCGGACACCCTC -3'
Posted On2016-12-20