Mutagenetix > Incidental Mutations

Incidental Mutation 'R0549:Pbxip1'

45012

Institutional Source

Beutler Lab

Gene Symbol

Pbxip1

Ensembl Gene

ENSMUSG00000042613

Gene Name

pre B cell leukemia transcription factor interacting protein 1

Synonyms

MMRRC Submission

038741-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R0549 (G1)

Quality Score

170

Status

Validated

Chromosome

Chromosomal Location

89436706-89450952 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 89443592 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000115904 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038942] [ENSMUST00000130858] [ENSMUST00000145753] [ENSMUST00000146630]

Predicted Effect

probably benign
Transcript: ENSMUST00000038942

SMART Domains

Protein: ENSMUSP00000040429
Gene: ENSMUSG00000042613

Domain	Start	End	E-Value	Type
low complexity region	142	152	N/A	INTRINSIC
low complexity region	162	177	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
coiled coil region	270	350	N/A	INTRINSIC
coiled coil region	379	405	N/A	INTRINSIC
low complexity region	672	691	N/A	INTRINSIC
low complexity region	692	703	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130858

SMART Domains

Protein: ENSMUSP00000118496
Gene: ENSMUSG00000042613

Domain	Start	End	E-Value	Type
low complexity region	149	159	N/A	INTRINSIC
low complexity region	169	184	N/A	INTRINSIC
transmembrane domain	194	216	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141340

Predicted Effect

probably benign
Transcript: ENSMUST00000145753

SMART Domains

Protein: ENSMUSP00000121658
Gene: ENSMUSG00000042613

Domain	Start	End	E-Value	Type
low complexity region	142	152	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000146630

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.3%

Validation Efficiency

96% (48/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the PBX1 homeodomain protein, inhibiting its transcriptional activation potential by preventing its binding to DNA. The encoded protein, which is primarily cytosolic but can shuttle to the nucleus, also can interact with estrogen receptors alpha and beta and promote the proliferation of breast cancer, brain tumors, and lung cancer. Several transcript variants encoding different isoforms have been found for this gene. More variants exist, but their full-length natures have yet to be determined. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	A	G	17: 46,322,290	F498L	probably damaging	Het
Adamts6	A	T	13: 104,297,255	D64V	possibly damaging	Het
Agbl2	T	C	2: 90,789,843		probably benign	Het
Angptl3	A	G	4: 99,031,455	S151G	probably benign	Het
Arhgap39	C	T	15: 76,734,886	D833N	probably damaging	Het
C4b	G	T	17: 34,735,415	L927I	probably damaging	Het
Ccl3	T	C	11: 83,648,336	T66A	probably damaging	Het
Cdh7	T	C	1: 110,108,944	L618P	probably damaging	Het
Cfap65	T	C	1: 74,918,444	T989A	probably benign	Het
Cnpy4	T	C	5: 138,187,637	F18S	possibly damaging	Het
Col6a5	A	G	9: 105,904,579		probably benign	Het
Dppa2	G	A	16: 48,318,671	R289H	probably benign	Het
Evx2	T	C	2: 74,659,134	T96A	probably benign	Het
Frmd4a	A	G	2: 4,603,967	E577G	possibly damaging	Het
Gcgr	G	A	11: 120,536,561	G166S	probably benign	Het
Gm4788	A	T	1: 139,739,488	D377E	probably damaging	Het
Gm5316	T	C	6: 122,900,191		noncoding transcript	Het
Gria1	G	A	11: 57,228,973	R292Q	probably damaging	Het
Hars2	T	A	18: 36,786,208		probably null	Het
Hkdc1	T	A	10: 62,400,240	T508S	probably benign	Het
Kif2b	A	T	11: 91,576,584	I291N	probably damaging	Het
Lmbrd1	A	T	1: 24,744,920	T377S	probably benign	Het
Lrrc28	A	G	7: 67,628,342		probably benign	Het
Mmp3	A	T	9: 7,455,638	N463I	probably benign	Het
Myh6	A	G	14: 54,958,608	F578S	probably damaging	Het
Ncbp1	T	A	4: 46,168,476	M608K	possibly damaging	Het
Nf1	T	C	11: 79,468,771	F1412L	probably damaging	Het
Nlrp5	T	A	7: 23,441,802	W1083R	probably damaging	Het
Nrsn1	T	C	13: 25,262,258	Y45C	probably benign	Het
Olfr401	T	G	11: 74,121,475	M62R	probably damaging	Het
Osbpl7	G	T	11: 97,067,542	R881L	probably damaging	Het
Papss1	A	G	3: 131,619,213	E456G	possibly damaging	Het
Pcca	A	G	14: 122,638,377		probably benign	Het
Pde1a	T	A	2: 79,865,070	N511I	probably damaging	Het
Prpf39	A	T	12: 65,056,256	I435F	probably benign	Het
Rnf213	C	T	11: 119,465,082	T4117M	probably damaging	Het
Sel1l2	A	T	2: 140,265,882	M216K	probably damaging	Het
Sidt2	A	G	9: 45,953,119		probably null	Het
Sirt3	A	T	7: 140,869,487		probably null	Het
Smpd4	T	C	16: 17,639,312	V378A	probably benign	Het
Svil	T	A	18: 5,064,566	S642T	possibly damaging	Het
Tcp10a	A	G	17: 7,326,551	K92E	probably benign	Het
Tmem144	T	C	3: 79,822,744	D233G	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Tnik	T	C	3: 28,570,920	S335P	possibly damaging	Het
Ush2a	T	C	1: 188,946,953	L4786P	probably damaging	Het
Utp11	A	T	4: 124,686,079		probably benign	Het
Vmn1r67	A	G	7: 10,447,714	N241D	probably damaging	Het
Vmn2r11	A	T	5: 109,052,097	C497S	possibly damaging	Het

Other mutations in Pbxip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01599:Pbxip1	APN	3	89443590	splice site	probably benign
IGL02612:Pbxip1	APN	3	89443681	missense	probably damaging	1.00
IGL02718:Pbxip1	APN	3	89448004	missense	probably damaging	1.00
R0538:Pbxip1	UTSW	3	89447619	missense	possibly damaging	0.79
R1460:Pbxip1	UTSW	3	89445614	missense	probably damaging	1.00
R1931:Pbxip1	UTSW	3	89447677	splice site	probably null
R1966:Pbxip1	UTSW	3	89445488	missense	probably damaging	1.00
R2008:Pbxip1	UTSW	3	89448713	missense	probably benign	0.20
R3435:Pbxip1	UTSW	3	89447236	missense	probably damaging	0.99
R4504:Pbxip1	UTSW	3	89446383	missense	possibly damaging	0.48
R4591:Pbxip1	UTSW	3	89446160	missense	probably benign	0.33
R5491:Pbxip1	UTSW	3	89443159	missense	probably benign	0.09
R6051:Pbxip1	UTSW	3	89443170	missense	probably benign	0.08
R6620:Pbxip1	UTSW	3	89447826	missense	probably benign	0.12
R7203:Pbxip1	UTSW	3	89447428	missense	possibly damaging	0.68
R7259:Pbxip1	UTSW	3	89445633	missense	probably benign
R7604:Pbxip1	UTSW	3	89445595	missense	probably benign	0.01
R7687:Pbxip1	UTSW	3	89448199	missense	probably damaging	1.00
R7710:Pbxip1	UTSW	3	89448101	missense	probably damaging	1.00
R7980:Pbxip1	UTSW	3	89446341	missense	probably benign	0.44
R8218:Pbxip1	UTSW	3	89445595	missense	probably benign
X0012:Pbxip1	UTSW	3	89445523	missense	possibly damaging	0.91
X0012:Pbxip1	UTSW	3	89446383	missense	possibly damaging	0.48
Z1177:Pbxip1	UTSW	3	89447220	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- AAGGGCTGCACTGTTCAGTTCAGG -3'
(R):5'- CATGCTTTCTAAAAGGTGGGCAACG -3'

Sequencing Primer
(F):5'- ACTGTTCAGTTCAGGGCTGTG -3'
(R):5'- GGCAAGATAGCCCCTGAC -3'

Posted On

2013-06-11