Incidental Mutation 'R5825:Dlec1'
ID450134
Institutional Source Beutler Lab
Gene Symbol Dlec1
Ensembl Gene ENSMUSG00000038060
Gene Namedeleted in lung and esophageal cancer 1
SynonymsD630005C06Rik
MMRRC Submission 044053-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5825 (G1)
Quality Score118
Status Not validated
Chromosome9
Chromosomal Location119102478-119148246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119142968 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1379 (I1379N)
Ref Sequence ENSEMBL: ENSMUSP00000128874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140326] [ENSMUST00000165231]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137047
Predicted Effect probably damaging
Transcript: ENSMUST00000140326
AA Change: I1379N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122380
Gene: ENSMUSG00000038060
AA Change: I1379N

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165231
AA Change: I1379N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128874
Gene: ENSMUSG00000038060
AA Change: I1379N

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1333 1354 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 95.3%
  • 20x: 83.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytogenetic location of this gene is 3p21.3, and it is located in a region that is commonly deleted in a variety of malignancies. Down-regulation of this gene has been observed in several human cancers including lung, esophageal, renal tumors, and head and neck squamous cell carcinoma. In some cases, reduced expression of this gene in tumor cells is a result of aberrant promoter methylation. Several alternatively spliced transcripts have been observed that contain disrupted coding regions and likely encode nonfunctional proteins.[provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A T 15: 60,920,127 Y217* probably null Het
Abca2 A T 2: 25,436,736 I567F probably benign Het
Acss2 T A 2: 155,549,178 probably null Het
Atxn7l2 C A 3: 108,204,811 A320S probably damaging Het
Bfsp1 C T 2: 143,827,459 G400D probably benign Het
Ces5a G T 8: 93,525,667 A199D probably damaging Het
Chd2 A T 7: 73,484,602 probably null Het
Crebbp A G 16: 4,087,742 V1705A probably damaging Het
Cyp2j8 T A 4: 96,507,214 Q58L probably benign Het
Dnah9 T C 11: 66,126,601 H593R probably benign Het
Ep300 T A 15: 81,611,472 C412S probably benign Het
Fam110a A G 2: 151,970,041 S270P probably damaging Het
Gcc2 A G 10: 58,294,821 T1412A probably damaging Het
Gm4788 T A 1: 139,774,598 probably null Het
Helz2 T C 2: 181,232,656 E2015G probably benign Het
Hormad1 T C 3: 95,562,559 V39A probably damaging Het
Igf2 G T 7: 142,653,855 H168Q probably damaging Het
Il18rap A G 1: 40,531,566 T223A probably benign Het
Itpr2 T C 6: 146,144,149 E2573G probably damaging Het
Jcad T A 18: 4,674,896 V886E probably benign Het
Klra1 T C 6: 130,380,629 R12G probably damaging Het
Lamb1 A G 12: 31,318,614 I1248V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk7 C T 11: 61,490,381 R465Q possibly damaging Het
Mogs T C 6: 83,118,212 V670A possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Ninl A T 2: 150,940,724 I1182N probably damaging Het
Nup160 A G 2: 90,679,770 probably null Het
Nynrin A G 14: 55,864,226 R451G probably benign Het
Olfr1126 A G 2: 87,457,450 D95G probably benign Het
Olfr190 T C 16: 59,074,661 I140V probably benign Het
Osbp A G 19: 11,970,721 T131A probably damaging Het
Pcdhga12 A C 18: 37,768,503 D796A possibly damaging Het
Pcdhgb8 G A 18: 37,762,236 V120I probably benign Het
Pdgfb A T 15: 79,997,668 V213E probably benign Het
Phldb2 T C 16: 45,763,097 M1013V probably benign Het
Pnmal1 A G 7: 16,961,095 S292G probably benign Het
Prrt4 A G 6: 29,177,183 S196P probably benign Het
Rap1gds1 T C 3: 138,955,375 M463V possibly damaging Het
Tmprss11g A T 5: 86,498,533 S58R probably damaging Het
Traf3 C A 12: 111,255,361 Q319K probably benign Het
Trappc8 C T 18: 20,873,920 V194M probably damaging Het
Tyw1 A G 5: 130,268,088 K182R probably damaging Het
Usp48 A G 4: 137,623,378 T585A probably benign Het
Xkr6 G T 14: 63,819,032 V387L probably benign Het
Yod1 T C 1: 130,719,006 W207R probably damaging Het
Zdhhc8 T C 16: 18,228,674 S63G probably null Het
Zfp827 A G 8: 79,179,016 E874G probably damaging Het
Zfy1 T A Y: 726,531 K411N possibly damaging Het
Other mutations in Dlec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Dlec1 APN 9 119102785 missense probably benign 0.11
IGL01137:Dlec1 APN 9 119137311 missense probably damaging 1.00
IGL01338:Dlec1 APN 9 119120911 missense probably damaging 1.00
IGL01652:Dlec1 APN 9 119143907 missense probably benign 0.01
IGL01923:Dlec1 APN 9 119128114 splice site probably null
IGL02186:Dlec1 APN 9 119143627 missense probably benign 0.00
IGL02597:Dlec1 APN 9 119134536 missense probably damaging 0.99
IGL02667:Dlec1 APN 9 119127466 missense probably benign 0.23
IGL02718:Dlec1 APN 9 119137286 missense probably benign 0.01
IGL02731:Dlec1 APN 9 119147120 missense probably benign 0.00
IGL02831:Dlec1 APN 9 119143915 missense probably damaging 1.00
IGL03390:Dlec1 APN 9 119123220 missense probably benign 0.00
I2288:Dlec1 UTSW 9 119143601 missense probably damaging 1.00
R0109:Dlec1 UTSW 9 119105824 missense probably damaging 1.00
R0144:Dlec1 UTSW 9 119142866 missense probably benign
R0554:Dlec1 UTSW 9 119115002 missense probably benign 0.44
R0611:Dlec1 UTSW 9 119112099 missense probably benign 0.01
R1344:Dlec1 UTSW 9 119130017 missense probably benign 0.09
R1467:Dlec1 UTSW 9 119142578 missense probably damaging 1.00
R1467:Dlec1 UTSW 9 119128003 splice site probably benign
R1467:Dlec1 UTSW 9 119142578 missense probably damaging 1.00
R1539:Dlec1 UTSW 9 119127450 missense probably benign 0.00
R1768:Dlec1 UTSW 9 119146007 splice site probably null
R1809:Dlec1 UTSW 9 119136699 missense probably benign 0.00
R1830:Dlec1 UTSW 9 119138790 missense probably benign 0.00
R1901:Dlec1 UTSW 9 119102644 missense probably damaging 0.99
R2060:Dlec1 UTSW 9 119112086 missense probably damaging 1.00
R2092:Dlec1 UTSW 9 119121844 missense possibly damaging 0.87
R2237:Dlec1 UTSW 9 119138191 critical splice donor site probably null
R2983:Dlec1 UTSW 9 119146173 missense probably benign 0.00
R3117:Dlec1 UTSW 9 119143903 splice site probably null
R3816:Dlec1 UTSW 9 119124843 missense probably damaging 1.00
R3826:Dlec1 UTSW 9 119143061 splice site probably benign
R3965:Dlec1 UTSW 9 119128581 missense probably benign 0.01
R4023:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4024:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4026:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4272:Dlec1 UTSW 9 119143163 missense probably damaging 0.98
R4545:Dlec1 UTSW 9 119128078 missense probably damaging 0.99
R4546:Dlec1 UTSW 9 119128078 missense probably damaging 0.99
R4601:Dlec1 UTSW 9 119147134 critical splice donor site probably null
R4695:Dlec1 UTSW 9 119143153 missense probably benign 0.00
R4996:Dlec1 UTSW 9 119146050 missense probably damaging 1.00
R5321:Dlec1 UTSW 9 119112601 missense probably benign 0.02
R5521:Dlec1 UTSW 9 119143401 missense possibly damaging 0.92
R5650:Dlec1 UTSW 9 119143594 nonsense probably null
R5941:Dlec1 UTSW 9 119126312 missense probably damaging 0.98
R6056:Dlec1 UTSW 9 119121923 missense probably damaging 0.98
R6111:Dlec1 UTSW 9 119102624 missense possibly damaging 0.59
R6156:Dlec1 UTSW 9 119110213 critical splice donor site probably null
R6160:Dlec1 UTSW 9 119143319 missense probably benign 0.02
R6195:Dlec1 UTSW 9 119137253 missense probably benign 0.00
R6364:Dlec1 UTSW 9 119121871 missense possibly damaging 0.84
R6480:Dlec1 UTSW 9 119147690 missense probably benign 0.34
R6808:Dlec1 UTSW 9 119126174 missense probably benign 0.01
R6813:Dlec1 UTSW 9 119112102 missense probably benign 0.02
R7019:Dlec1 UTSW 9 119112422 missense probably benign 0.01
R7048:Dlec1 UTSW 9 119143404 splice site probably null
R7187:Dlec1 UTSW 9 119112146 missense probably benign 0.14
R7230:Dlec1 UTSW 9 119124538 splice site probably null
R7585:Dlec1 UTSW 9 119142751 missense probably benign 0.06
R8342:Dlec1 UTSW 9 119139389 missense probably benign 0.01
R8480:Dlec1 UTSW 9 119143267 splice site probably null
R8481:Dlec1 UTSW 9 119143267 splice site probably null
R8485:Dlec1 UTSW 9 119128591 missense probably benign 0.33
R8520:Dlec1 UTSW 9 119112209 missense probably benign 0.00
R8556:Dlec1 UTSW 9 119126221 missense probably benign 0.13
R8755:Dlec1 UTSW 9 119138157 missense probably damaging 1.00
R8805:Dlec1 UTSW 9 119112582 missense probably benign
R8813:Dlec1 UTSW 9 119127430 missense probably benign 0.16
Z1176:Dlec1 UTSW 9 119138786 missense probably benign 0.13
Z1177:Dlec1 UTSW 9 119134473 missense probably benign 0.34
Z1177:Dlec1 UTSW 9 119147409 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCTCAGTGTCTAGCCACAC -3'
(R):5'- ATACCCCACCTTGTGCATGAC -3'

Sequencing Primer
(F):5'- ACTGTCCCCTCAACGGTG -3'
(R):5'- ACCTTGTGCATGACCCCTGG -3'
Posted On2016-12-20