Mutagenetix > Incidental Mutation

Incidental Mutation 'R5825:Lamb1'

450138

Institutional Source

Beutler Lab

Gene Symbol

Lamb1

Ensembl Gene

ENSMUSG00000002900

Gene Name

laminin B1

Synonyms

C80098, C81607, Lamb1-1, Lamb-1, D130003D08Rik

MMRRC Submission

044053-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5825 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31265234-31329644 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 31318614 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1248 (I1248V)

Ref Sequence

ENSEMBL: ENSMUSP00000132778 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002979] [ENSMUST00000169088]

AlphaFold

P02469

PDB Structure

Laminin beta1 LN-LE1-4 structure [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000002979
AA Change: I1296V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000002979
Gene: ENSMUSG00000002900
AA Change: I1296V

Domain	Start	End	E-Value	Type
low complexity region	32	45	N/A	INTRINSIC
LamNT	77	317	3.24e-96	SMART
EGF_Lam	319	380	1.34e-6	SMART
EGF_Lam	383	443	1.33e-10	SMART
EGF_Lam	446	503	2.89e-11	SMART
EGF_Lam	506	555	2.89e-11	SMART
EGF_Lam	558	602	3.4e-8	SMART
EGF_Lam	821	866	4.99e-15	SMART
EGF_Lam	869	912	2.38e-12	SMART
EGF_Lam	915	962	2.4e-8	SMART
EGF_Lam	965	1021	1.41e-5	SMART
EGF_Lam	1024	1073	4.81e-8	SMART
EGF_Lam	1076	1129	3.81e-11	SMART
EGF_Lam	1132	1177	5.61e-9	SMART
EGF_Lam	1180	1224	2.89e-11	SMART
coiled coil region	1329	1360	N/A	INTRINSIC
low complexity region	1468	1480	N/A	INTRINSIC
coiled coil region	1497	1551	N/A	INTRINSIC
coiled coil region	1600	1826	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169088
AA Change: I1248V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000132778
Gene: ENSMUSG00000002900
AA Change: I1248V

Domain	Start	End	E-Value	Type
LamNT	29	269	3.24e-96	SMART
EGF_Lam	271	332	1.34e-6	SMART
EGF_Lam	335	395	1.33e-10	SMART
EGF_Lam	398	455	2.89e-11	SMART
EGF_Lam	458	507	2.89e-11	SMART
EGF_Lam	510	554	3.4e-8	SMART
EGF_Lam	773	818	4.99e-15	SMART
EGF_Lam	821	864	2.38e-12	SMART
EGF_Lam	867	914	2.4e-8	SMART
EGF_Lam	917	973	1.41e-5	SMART
EGF_Lam	976	1025	4.81e-8	SMART
EGF_Lam	1028	1081	3.81e-11	SMART
EGF_Lam	1084	1129	5.61e-9	SMART
EGF_Lam	1132	1176	2.89e-11	SMART
coiled coil region	1281	1312	N/A	INTRINSIC
low complexity region	1420	1432	N/A	INTRINSIC
coiled coil region	1449	1503	N/A	INTRINSIC
coiled coil region	1552	1778	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172134

Coding Region Coverage

1x: 99.8%
3x: 99.1%
10x: 95.3%
20x: 83.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 1. The beta 1 chain has 7 structurally distinct domains which it shares with other beta chain isomers. The C-terminal helical region containing domains I and II are separated by domain alpha, domains III and V contain several EGF-like repeats, and domains IV and VI have a globular conformation. Laminin, beta 1 is expressed in most tissues that produce basement membranes, and is one of the 3 chains constituting laminin 1, the first laminin isolated from Engelbreth-Holm-Swarm (EHS) tumor. A sequence in the beta 1 chain that is involved in cell attachment, chemotaxis, and binding to the laminin receptor was identified and shown to have the capacity to inhibit metastasis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a gene trapped allele lack basement membranes and fail to survive past E5.5. Mice heterozygous for a spontaneous mutation exhibit dystonis with impaired neuron firing. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	A	T	15: 60,920,127	Y217*	probably null	Het
Abca2	A	T	2: 25,436,736	I567F	probably benign	Het
Acss2	T	A	2: 155,549,178		probably null	Het
Atxn7l2	C	A	3: 108,204,811	A320S	probably damaging	Het
Bfsp1	C	T	2: 143,827,459	G400D	probably benign	Het
Ces5a	G	T	8: 93,525,667	A199D	probably damaging	Het
Chd2	A	T	7: 73,484,602		probably null	Het
Crebbp	A	G	16: 4,087,742	V1705A	probably damaging	Het
Cyp2j8	T	A	4: 96,507,214	Q58L	probably benign	Het
Dlec1	T	A	9: 119,142,968	I1379N	probably damaging	Het
Dnah9	T	C	11: 66,126,601	H593R	probably benign	Het
Ep300	T	A	15: 81,611,472	C412S	probably benign	Het
Fam110a	A	G	2: 151,970,041	S270P	probably damaging	Het
Gcc2	A	G	10: 58,294,821	T1412A	probably damaging	Het
Gm4788	T	A	1: 139,774,598		probably null	Het
Helz2	T	C	2: 181,232,656	E2015G	probably benign	Het
Hormad1	T	C	3: 95,562,559	V39A	probably damaging	Het
Igf2	G	T	7: 142,653,855	H168Q	probably damaging	Het
Il18rap	A	G	1: 40,531,566	T223A	probably benign	Het
Itpr2	T	C	6: 146,144,149	E2573G	probably damaging	Het
Jcad	T	A	18: 4,674,896	V886E	probably benign	Het
Klra1	T	C	6: 130,380,629	R12G	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Mapk7	C	T	11: 61,490,381	R465Q	possibly damaging	Het
Mogs	T	C	6: 83,118,212	V670A	possibly damaging	Het
Mroh2a	C	T	1: 88,230,680	R150*	probably null	Het
Ninl	A	T	2: 150,940,724	I1182N	probably damaging	Het
Nup160	A	G	2: 90,679,770		probably null	Het
Nynrin	A	G	14: 55,864,226	R451G	probably benign	Het
Olfr1126	A	G	2: 87,457,450	D95G	probably benign	Het
Olfr190	T	C	16: 59,074,661	I140V	probably benign	Het
Osbp	A	G	19: 11,970,721	T131A	probably damaging	Het
Pcdhga12	A	C	18: 37,768,503	D796A	possibly damaging	Het
Pcdhgb8	G	A	18: 37,762,236	V120I	probably benign	Het
Pdgfb	A	T	15: 79,997,668	V213E	probably benign	Het
Phldb2	T	C	16: 45,763,097	M1013V	probably benign	Het
Pnmal1	A	G	7: 16,961,095	S292G	probably benign	Het
Prrt4	A	G	6: 29,177,183	S196P	probably benign	Het
Rap1gds1	T	C	3: 138,955,375	M463V	possibly damaging	Het
Tmprss11g	A	T	5: 86,498,533	S58R	probably damaging	Het
Traf3	C	A	12: 111,255,361	Q319K	probably benign	Het
Trappc8	C	T	18: 20,873,920	V194M	probably damaging	Het
Tyw1	A	G	5: 130,268,088	K182R	probably damaging	Het
Usp48	A	G	4: 137,623,378	T585A	probably benign	Het
Xkr6	G	T	14: 63,819,032	V387L	probably benign	Het
Yod1	T	C	1: 130,719,006	W207R	probably damaging	Het
Zdhhc8	T	C	16: 18,228,674	S63G	probably null	Het
Zfp827	A	G	8: 79,179,016	E874G	probably damaging	Het
Zfy1	T	A	Y: 726,531	K411N	possibly damaging	Het

Other mutations in Lamb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Lamb1	APN	12	31298826	missense	possibly damaging	0.74
IGL00939:Lamb1	APN	12	31302927	missense	probably damaging	1.00
IGL01017:Lamb1	APN	12	31301064	missense	possibly damaging	0.89
IGL01384:Lamb1	APN	12	31320931	missense	probably benign	0.09
IGL01470:Lamb1	APN	12	31300262	missense	possibly damaging	0.55
IGL01554:Lamb1	APN	12	31306977	missense	probably damaging	1.00
IGL02207:Lamb1	APN	12	31329435	missense	probably damaging	1.00
IGL02271:Lamb1	APN	12	31300251	missense	probably damaging	1.00
IGL02272:Lamb1	APN	12	31305769	missense	probably benign	0.00
IGL02365:Lamb1	APN	12	31318345	missense	probably damaging	1.00
IGL02471:Lamb1	APN	12	31320908	missense	probably damaging	1.00
IGL02704:Lamb1	APN	12	31318467	missense	probably benign	0.05
IGL03132:Lamb1	APN	12	31300334	splice site	probably null
IGL03161:Lamb1	APN	12	31326256	missense	probably benign	0.41
IGL03169:Lamb1	APN	12	31323646	missense	probably damaging	1.00
Crush	UTSW	12	31287424	missense	probably damaging	1.00
Deflationary	UTSW	12	31321075	missense	probably null	0.63
E0374:Lamb1	UTSW	12	31287930	missense	probably damaging	1.00
P0043:Lamb1	UTSW	12	31278621	missense	probably damaging	1.00
R0031:Lamb1	UTSW	12	31301156	missense	probably benign	0.04
R0047:Lamb1	UTSW	12	31278601	missense	possibly damaging	0.51
R0047:Lamb1	UTSW	12	31278601	missense	possibly damaging	0.51
R0285:Lamb1	UTSW	12	31326645	nonsense	probably null
R0456:Lamb1	UTSW	12	31304730	missense	probably damaging	1.00
R0477:Lamb1	UTSW	12	31326269	missense	possibly damaging	0.47
R0480:Lamb1	UTSW	12	31282721	missense	possibly damaging	0.79
R0544:Lamb1	UTSW	12	31282695	missense	probably damaging	1.00
R0565:Lamb1	UTSW	12	31298915	missense	probably benign	0.02
R1500:Lamb1	UTSW	12	31298949	missense	possibly damaging	0.82
R1624:Lamb1	UTSW	12	31278652	critical splice donor site	probably null
R1772:Lamb1	UTSW	12	31278525	missense	probably damaging	1.00
R1836:Lamb1	UTSW	12	31301094	missense	probably benign	0.00
R1853:Lamb1	UTSW	12	31318272	missense	probably damaging	1.00
R1854:Lamb1	UTSW	12	31318272	missense	probably damaging	1.00
R1903:Lamb1	UTSW	12	31329210	missense	probably damaging	1.00
R2091:Lamb1	UTSW	12	31287429	missense	probably damaging	0.98
R2186:Lamb1	UTSW	12	31318467	nonsense	probably null
R2268:Lamb1	UTSW	12	31327645	missense	probably damaging	1.00
R2567:Lamb1	UTSW	12	31269055	critical splice acceptor site	probably null
R2698:Lamb1	UTSW	12	31298883	missense	probably benign	0.10
R3121:Lamb1	UTSW	12	31287529	missense	probably damaging	1.00
R3405:Lamb1	UTSW	12	31287529	missense	probably damaging	1.00
R3406:Lamb1	UTSW	12	31287529	missense	probably damaging	1.00
R3608:Lamb1	UTSW	12	31287910	missense	probably damaging	1.00
R3725:Lamb1	UTSW	12	31321075	missense	probably null	0.63
R3726:Lamb1	UTSW	12	31321075	missense	probably null	0.63
R3949:Lamb1	UTSW	12	31282649	missense	probably damaging	1.00
R4308:Lamb1	UTSW	12	31329255	missense	probably damaging	1.00
R4600:Lamb1	UTSW	12	31323529	missense	probably benign	0.00
R4604:Lamb1	UTSW	12	31278776	missense	probably damaging	1.00
R4701:Lamb1	UTSW	12	31266848	nonsense	probably null
R4710:Lamb1	UTSW	12	31282583	missense	probably benign	0.02
R4767:Lamb1	UTSW	12	31308011	missense	probably damaging	1.00
R4809:Lamb1	UTSW	12	31278526	missense	probably damaging	1.00
R4828:Lamb1	UTSW	12	31298930	missense	probably benign
R4842:Lamb1	UTSW	12	31287433	missense	probably damaging	1.00
R4864:Lamb1	UTSW	12	31321006	missense	probably benign	0.01
R4909:Lamb1	UTSW	12	31288281	missense	probably damaging	1.00
R4989:Lamb1	UTSW	12	31326678	missense	probably damaging	1.00
R5444:Lamb1	UTSW	12	31298909	missense	possibly damaging	0.47
R5736:Lamb1	UTSW	12	31302665	nonsense	probably null
R5766:Lamb1	UTSW	12	31299931	missense	probably damaging	1.00
R5840:Lamb1	UTSW	12	31266756	missense	probably damaging	1.00
R5867:Lamb1	UTSW	12	31298955	missense	possibly damaging	0.82
R5887:Lamb1	UTSW	12	31266864	nonsense	probably null
R5984:Lamb1	UTSW	12	31327774	missense	possibly damaging	0.76
R6313:Lamb1	UTSW	12	31269147	missense	probably damaging	1.00
R6359:Lamb1	UTSW	12	31282716	missense	probably damaging	0.97
R6505:Lamb1	UTSW	12	31323462	missense	possibly damaging	0.63
R7127:Lamb1	UTSW	12	31324315	missense	probably damaging	1.00
R7202:Lamb1	UTSW	12	31324315	missense	probably damaging	1.00
R7271:Lamb1	UTSW	12	31287424	missense	probably damaging	1.00
R7290:Lamb1	UTSW	12	31265596	missense	probably benign	0.04
R7486:Lamb1	UTSW	12	31287442	missense	probably benign	0.00
R7496:Lamb1	UTSW	12	31300021	missense	probably benign	0.31
R7591:Lamb1	UTSW	12	31326648	missense	probably damaging	1.00
R7722:Lamb1	UTSW	12	31323571	missense	probably damaging	0.99
R7985:Lamb1	UTSW	12	31300215	missense	possibly damaging	0.93
R8058:Lamb1	UTSW	12	31303047	missense	probably benign	0.16
R8353:Lamb1	UTSW	12	31306999	missense	probably damaging	1.00
R8506:Lamb1	UTSW	12	31329361	missense	probably damaging	1.00
R8846:Lamb1	UTSW	12	31329389	missense	possibly damaging	0.75
R8888:Lamb1	UTSW	12	31302954	missense	possibly damaging	0.95
R8895:Lamb1	UTSW	12	31302954	missense	possibly damaging	0.95
R9312:Lamb1	UTSW	12	31318353	missense	probably damaging	1.00
R9340:Lamb1	UTSW	12	31324224	missense	probably benign
R9340:Lamb1	UTSW	12	31324225	missense	probably benign
R9371:Lamb1	UTSW	12	31298864	missense	probably damaging	0.98
R9417:Lamb1	UTSW	12	31287984	missense	probably damaging	1.00
R9562:Lamb1	UTSW	12	31272493	missense	probably damaging	1.00
R9626:Lamb1	UTSW	12	31304670	missense	probably benign
R9641:Lamb1	UTSW	12	31287458	missense	probably damaging	0.97
X0054:Lamb1	UTSW	12	31287434	missense	probably damaging	1.00
X0064:Lamb1	UTSW	12	31303042	missense	probably benign	0.35
Z1176:Lamb1	UTSW	12	31327702	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- TGCTATCATTGGTGAGCTGAC -3'
(R):5'- GATCTTCTGCCTCAAGTCCAG -3'

Sequencing Primer
(F):5'- GTGAGCTGACCAACAGGACC -3'
(R):5'- TCAAGTCCAGTCCAGCTGC -3'

Posted On

2016-12-20