Incidental Mutation 'R5825:Lamb1'
ID 450138
Institutional Source Beutler Lab
Gene Symbol Lamb1
Ensembl Gene ENSMUSG00000002900
Gene Name laminin B1
Synonyms Lamb-1, D130003D08Rik, C80098, C81607, Lamb1-1
MMRRC Submission 044053-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5825 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 31315233-31379643 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 31368613 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1248 (I1248V)
Ref Sequence ENSEMBL: ENSMUSP00000132778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002979] [ENSMUST00000169088]
AlphaFold P02469
PDB Structure Laminin beta1 LN-LE1-4 structure [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000002979
AA Change: I1296V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002979
Gene: ENSMUSG00000002900
AA Change: I1296V

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
LamNT 77 317 3.24e-96 SMART
EGF_Lam 319 380 1.34e-6 SMART
EGF_Lam 383 443 1.33e-10 SMART
EGF_Lam 446 503 2.89e-11 SMART
EGF_Lam 506 555 2.89e-11 SMART
EGF_Lam 558 602 3.4e-8 SMART
EGF_Lam 821 866 4.99e-15 SMART
EGF_Lam 869 912 2.38e-12 SMART
EGF_Lam 915 962 2.4e-8 SMART
EGF_Lam 965 1021 1.41e-5 SMART
EGF_Lam 1024 1073 4.81e-8 SMART
EGF_Lam 1076 1129 3.81e-11 SMART
EGF_Lam 1132 1177 5.61e-9 SMART
EGF_Lam 1180 1224 2.89e-11 SMART
coiled coil region 1329 1360 N/A INTRINSIC
low complexity region 1468 1480 N/A INTRINSIC
coiled coil region 1497 1551 N/A INTRINSIC
coiled coil region 1600 1826 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169088
AA Change: I1248V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132778
Gene: ENSMUSG00000002900
AA Change: I1248V

DomainStartEndE-ValueType
LamNT 29 269 3.24e-96 SMART
EGF_Lam 271 332 1.34e-6 SMART
EGF_Lam 335 395 1.33e-10 SMART
EGF_Lam 398 455 2.89e-11 SMART
EGF_Lam 458 507 2.89e-11 SMART
EGF_Lam 510 554 3.4e-8 SMART
EGF_Lam 773 818 4.99e-15 SMART
EGF_Lam 821 864 2.38e-12 SMART
EGF_Lam 867 914 2.4e-8 SMART
EGF_Lam 917 973 1.41e-5 SMART
EGF_Lam 976 1025 4.81e-8 SMART
EGF_Lam 1028 1081 3.81e-11 SMART
EGF_Lam 1084 1129 5.61e-9 SMART
EGF_Lam 1132 1176 2.89e-11 SMART
coiled coil region 1281 1312 N/A INTRINSIC
low complexity region 1420 1432 N/A INTRINSIC
coiled coil region 1449 1503 N/A INTRINSIC
coiled coil region 1552 1778 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172134
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 95.3%
  • 20x: 83.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 1. The beta 1 chain has 7 structurally distinct domains which it shares with other beta chain isomers. The C-terminal helical region containing domains I and II are separated by domain alpha, domains III and V contain several EGF-like repeats, and domains IV and VI have a globular conformation. Laminin, beta 1 is expressed in most tissues that produce basement membranes, and is one of the 3 chains constituting laminin 1, the first laminin isolated from Engelbreth-Holm-Swarm (EHS) tumor. A sequence in the beta 1 chain that is involved in cell attachment, chemotaxis, and binding to the laminin receptor was identified and shown to have the capacity to inhibit metastasis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a gene trapped allele lack basement membranes and fail to survive past E5.5. Mice heterozygous for a spontaneous mutation exhibit dystonis with impaired neuron firing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A T 15: 60,791,976 (GRCm39) Y217* probably null Het
Abca2 A T 2: 25,326,748 (GRCm39) I567F probably benign Het
Acss2 T A 2: 155,391,098 (GRCm39) probably null Het
Atxn7l2 C A 3: 108,112,127 (GRCm39) A320S probably damaging Het
Bfsp1 C T 2: 143,669,379 (GRCm39) G400D probably benign Het
Ces5a G T 8: 94,252,295 (GRCm39) A199D probably damaging Het
Cfhr4 T A 1: 139,702,336 (GRCm39) probably null Het
Chd2 A T 7: 73,134,350 (GRCm39) probably null Het
Crebbp A G 16: 3,905,606 (GRCm39) V1705A probably damaging Het
Cyp2j8 T A 4: 96,395,451 (GRCm39) Q58L probably benign Het
Dlec1 T A 9: 118,972,036 (GRCm39) I1379N probably damaging Het
Dnah9 T C 11: 66,017,427 (GRCm39) H593R probably benign Het
Ep300 T A 15: 81,495,673 (GRCm39) C412S probably benign Het
Fam110a A G 2: 151,811,961 (GRCm39) S270P probably damaging Het
Gcc2 A G 10: 58,130,643 (GRCm39) T1412A probably damaging Het
Helz2 T C 2: 180,874,449 (GRCm39) E2015G probably benign Het
Hormad1 T C 3: 95,469,870 (GRCm39) V39A probably damaging Het
Igf2 G T 7: 142,207,592 (GRCm39) H168Q probably damaging Het
Il18rap A G 1: 40,570,726 (GRCm39) T223A probably benign Het
Itpr2 T C 6: 146,045,647 (GRCm39) E2573G probably damaging Het
Jcad T A 18: 4,674,896 (GRCm39) V886E probably benign Het
Klra1 T C 6: 130,357,592 (GRCm39) R12G probably damaging Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Mapk7 C T 11: 61,381,207 (GRCm39) R465Q possibly damaging Het
Mogs T C 6: 83,095,193 (GRCm39) V670A possibly damaging Het
Mroh2a C T 1: 88,158,402 (GRCm39) R150* probably null Het
Ninl A T 2: 150,782,644 (GRCm39) I1182N probably damaging Het
Nup160 A G 2: 90,510,114 (GRCm39) probably null Het
Nynrin A G 14: 56,101,683 (GRCm39) R451G probably benign Het
Or12e7 A G 2: 87,287,794 (GRCm39) D95G probably benign Het
Or5h22 T C 16: 58,895,024 (GRCm39) I140V probably benign Het
Osbp A G 19: 11,948,085 (GRCm39) T131A probably damaging Het
Pcdhga12 A C 18: 37,901,556 (GRCm39) D796A possibly damaging Het
Pcdhgb8 G A 18: 37,895,289 (GRCm39) V120I probably benign Het
Pdgfb A T 15: 79,881,869 (GRCm39) V213E probably benign Het
Phldb2 T C 16: 45,583,460 (GRCm39) M1013V probably benign Het
Pnma8a A G 7: 16,695,020 (GRCm39) S292G probably benign Het
Prrt4 A G 6: 29,177,182 (GRCm39) S196P probably benign Het
Rap1gds1 T C 3: 138,661,136 (GRCm39) M463V possibly damaging Het
Tmprss11g A T 5: 86,646,392 (GRCm39) S58R probably damaging Het
Traf3 C A 12: 111,221,795 (GRCm39) Q319K probably benign Het
Trappc8 C T 18: 21,006,977 (GRCm39) V194M probably damaging Het
Tyw1 A G 5: 130,296,929 (GRCm39) K182R probably damaging Het
Usp48 A G 4: 137,350,689 (GRCm39) T585A probably benign Het
Xkr6 G T 14: 64,056,481 (GRCm39) V387L probably benign Het
Yod1 T C 1: 130,646,743 (GRCm39) W207R probably damaging Het
Zdhhc8 T C 16: 18,046,538 (GRCm39) S63G probably null Het
Zfp827 A G 8: 79,905,645 (GRCm39) E874G probably damaging Het
Zfy1 T A Y: 726,531 (GRCm39) K411N possibly damaging Het
Other mutations in Lamb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Lamb1 APN 12 31,348,825 (GRCm39) missense possibly damaging 0.74
IGL00939:Lamb1 APN 12 31,352,926 (GRCm39) missense probably damaging 1.00
IGL01017:Lamb1 APN 12 31,351,063 (GRCm39) missense possibly damaging 0.89
IGL01384:Lamb1 APN 12 31,370,930 (GRCm39) missense probably benign 0.09
IGL01470:Lamb1 APN 12 31,350,261 (GRCm39) missense possibly damaging 0.55
IGL01554:Lamb1 APN 12 31,356,976 (GRCm39) missense probably damaging 1.00
IGL02207:Lamb1 APN 12 31,379,434 (GRCm39) missense probably damaging 1.00
IGL02271:Lamb1 APN 12 31,350,250 (GRCm39) missense probably damaging 1.00
IGL02272:Lamb1 APN 12 31,355,768 (GRCm39) missense probably benign 0.00
IGL02365:Lamb1 APN 12 31,368,344 (GRCm39) missense probably damaging 1.00
IGL02471:Lamb1 APN 12 31,370,907 (GRCm39) missense probably damaging 1.00
IGL02704:Lamb1 APN 12 31,368,466 (GRCm39) missense probably benign 0.05
IGL03132:Lamb1 APN 12 31,350,333 (GRCm39) splice site probably null
IGL03161:Lamb1 APN 12 31,376,255 (GRCm39) missense probably benign 0.41
IGL03169:Lamb1 APN 12 31,373,645 (GRCm39) missense probably damaging 1.00
Crush UTSW 12 31,337,423 (GRCm39) missense probably damaging 1.00
Deflationary UTSW 12 31,371,074 (GRCm39) missense probably null 0.63
E0374:Lamb1 UTSW 12 31,337,929 (GRCm39) missense probably damaging 1.00
P0043:Lamb1 UTSW 12 31,328,620 (GRCm39) missense probably damaging 1.00
R0031:Lamb1 UTSW 12 31,351,155 (GRCm39) missense probably benign 0.04
R0047:Lamb1 UTSW 12 31,328,600 (GRCm39) missense possibly damaging 0.51
R0047:Lamb1 UTSW 12 31,328,600 (GRCm39) missense possibly damaging 0.51
R0285:Lamb1 UTSW 12 31,376,644 (GRCm39) nonsense probably null
R0456:Lamb1 UTSW 12 31,354,729 (GRCm39) missense probably damaging 1.00
R0477:Lamb1 UTSW 12 31,376,268 (GRCm39) missense possibly damaging 0.47
R0480:Lamb1 UTSW 12 31,332,720 (GRCm39) missense possibly damaging 0.79
R0544:Lamb1 UTSW 12 31,332,694 (GRCm39) missense probably damaging 1.00
R0565:Lamb1 UTSW 12 31,348,914 (GRCm39) missense probably benign 0.02
R1500:Lamb1 UTSW 12 31,348,948 (GRCm39) missense possibly damaging 0.82
R1624:Lamb1 UTSW 12 31,328,651 (GRCm39) critical splice donor site probably null
R1772:Lamb1 UTSW 12 31,328,524 (GRCm39) missense probably damaging 1.00
R1836:Lamb1 UTSW 12 31,351,093 (GRCm39) missense probably benign 0.00
R1853:Lamb1 UTSW 12 31,368,271 (GRCm39) missense probably damaging 1.00
R1854:Lamb1 UTSW 12 31,368,271 (GRCm39) missense probably damaging 1.00
R1903:Lamb1 UTSW 12 31,379,209 (GRCm39) missense probably damaging 1.00
R2091:Lamb1 UTSW 12 31,337,428 (GRCm39) missense probably damaging 0.98
R2186:Lamb1 UTSW 12 31,368,466 (GRCm39) nonsense probably null
R2268:Lamb1 UTSW 12 31,377,644 (GRCm39) missense probably damaging 1.00
R2567:Lamb1 UTSW 12 31,319,054 (GRCm39) critical splice acceptor site probably null
R2698:Lamb1 UTSW 12 31,348,882 (GRCm39) missense probably benign 0.10
R3121:Lamb1 UTSW 12 31,337,528 (GRCm39) missense probably damaging 1.00
R3405:Lamb1 UTSW 12 31,337,528 (GRCm39) missense probably damaging 1.00
R3406:Lamb1 UTSW 12 31,337,528 (GRCm39) missense probably damaging 1.00
R3608:Lamb1 UTSW 12 31,337,909 (GRCm39) missense probably damaging 1.00
R3725:Lamb1 UTSW 12 31,371,074 (GRCm39) missense probably null 0.63
R3726:Lamb1 UTSW 12 31,371,074 (GRCm39) missense probably null 0.63
R3949:Lamb1 UTSW 12 31,332,648 (GRCm39) missense probably damaging 1.00
R4308:Lamb1 UTSW 12 31,379,254 (GRCm39) missense probably damaging 1.00
R4600:Lamb1 UTSW 12 31,373,528 (GRCm39) missense probably benign 0.00
R4604:Lamb1 UTSW 12 31,328,775 (GRCm39) missense probably damaging 1.00
R4701:Lamb1 UTSW 12 31,316,847 (GRCm39) nonsense probably null
R4710:Lamb1 UTSW 12 31,332,582 (GRCm39) missense probably benign 0.02
R4767:Lamb1 UTSW 12 31,358,010 (GRCm39) missense probably damaging 1.00
R4809:Lamb1 UTSW 12 31,328,525 (GRCm39) missense probably damaging 1.00
R4828:Lamb1 UTSW 12 31,348,929 (GRCm39) missense probably benign
R4842:Lamb1 UTSW 12 31,337,432 (GRCm39) missense probably damaging 1.00
R4864:Lamb1 UTSW 12 31,371,005 (GRCm39) missense probably benign 0.01
R4909:Lamb1 UTSW 12 31,338,280 (GRCm39) missense probably damaging 1.00
R4989:Lamb1 UTSW 12 31,376,677 (GRCm39) missense probably damaging 1.00
R5444:Lamb1 UTSW 12 31,348,908 (GRCm39) missense possibly damaging 0.47
R5736:Lamb1 UTSW 12 31,352,664 (GRCm39) nonsense probably null
R5766:Lamb1 UTSW 12 31,349,930 (GRCm39) missense probably damaging 1.00
R5840:Lamb1 UTSW 12 31,316,755 (GRCm39) missense probably damaging 1.00
R5867:Lamb1 UTSW 12 31,348,954 (GRCm39) missense possibly damaging 0.82
R5887:Lamb1 UTSW 12 31,316,863 (GRCm39) nonsense probably null
R5984:Lamb1 UTSW 12 31,377,773 (GRCm39) missense possibly damaging 0.76
R6313:Lamb1 UTSW 12 31,319,146 (GRCm39) missense probably damaging 1.00
R6359:Lamb1 UTSW 12 31,332,715 (GRCm39) missense probably damaging 0.97
R6505:Lamb1 UTSW 12 31,373,461 (GRCm39) missense possibly damaging 0.63
R7127:Lamb1 UTSW 12 31,374,314 (GRCm39) missense probably damaging 1.00
R7202:Lamb1 UTSW 12 31,374,314 (GRCm39) missense probably damaging 1.00
R7271:Lamb1 UTSW 12 31,337,423 (GRCm39) missense probably damaging 1.00
R7290:Lamb1 UTSW 12 31,315,595 (GRCm39) missense probably benign 0.04
R7486:Lamb1 UTSW 12 31,337,441 (GRCm39) missense probably benign 0.00
R7496:Lamb1 UTSW 12 31,350,020 (GRCm39) missense probably benign 0.31
R7591:Lamb1 UTSW 12 31,376,647 (GRCm39) missense probably damaging 1.00
R7722:Lamb1 UTSW 12 31,373,570 (GRCm39) missense probably damaging 0.99
R7985:Lamb1 UTSW 12 31,350,214 (GRCm39) missense possibly damaging 0.93
R8058:Lamb1 UTSW 12 31,353,046 (GRCm39) missense probably benign 0.16
R8353:Lamb1 UTSW 12 31,356,998 (GRCm39) missense probably damaging 1.00
R8506:Lamb1 UTSW 12 31,379,360 (GRCm39) missense probably damaging 1.00
R8846:Lamb1 UTSW 12 31,379,388 (GRCm39) missense possibly damaging 0.75
R8888:Lamb1 UTSW 12 31,352,953 (GRCm39) missense possibly damaging 0.95
R8895:Lamb1 UTSW 12 31,352,953 (GRCm39) missense possibly damaging 0.95
R9312:Lamb1 UTSW 12 31,368,352 (GRCm39) missense probably damaging 1.00
R9340:Lamb1 UTSW 12 31,374,224 (GRCm39) missense probably benign
R9340:Lamb1 UTSW 12 31,374,223 (GRCm39) missense probably benign
R9371:Lamb1 UTSW 12 31,348,863 (GRCm39) missense probably damaging 0.98
R9417:Lamb1 UTSW 12 31,337,983 (GRCm39) missense probably damaging 1.00
R9562:Lamb1 UTSW 12 31,322,492 (GRCm39) missense probably damaging 1.00
R9626:Lamb1 UTSW 12 31,354,669 (GRCm39) missense probably benign
R9641:Lamb1 UTSW 12 31,337,457 (GRCm39) missense probably damaging 0.97
X0054:Lamb1 UTSW 12 31,337,433 (GRCm39) missense probably damaging 1.00
X0064:Lamb1 UTSW 12 31,353,041 (GRCm39) missense probably benign 0.35
Z1176:Lamb1 UTSW 12 31,377,701 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TGCTATCATTGGTGAGCTGAC -3'
(R):5'- GATCTTCTGCCTCAAGTCCAG -3'

Sequencing Primer
(F):5'- GTGAGCTGACCAACAGGACC -3'
(R):5'- TCAAGTCCAGTCCAGCTGC -3'
Posted On 2016-12-20