Incidental Mutation 'R5825:Zdhhc8'
ID450144
Institutional Source Beutler Lab
Gene Symbol Zdhhc8
Ensembl Gene ENSMUSG00000060166
Gene Namezinc finger, DHHC domain containing 8
SynonymsOp53c05, E330009O14Rik, D16H22S1738E
MMRRC Submission 044053-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.730) question?
Stock #R5825 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location18220753-18235136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18228674 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 63 (S63G)
Ref Sequence ENSEMBL: ENSMUSP00000076224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076957]
Predicted Effect probably null
Transcript: ENSMUST00000076957
AA Change: S63G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076224
Gene: ENSMUSG00000060166
AA Change: S63G

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
Pfam:zf-DHHC 99 224 4.8e-36 PFAM
low complexity region 304 318 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
low complexity region 551 563 N/A INTRINSIC
low complexity region 619 644 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231412
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 95.3%
  • 20x: 83.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a four transmembrane protein that is a member of the zinc finger DHHC domain-containing protein family. The encoded protein may function as a palmitoyltransferase. Defects in this gene may be associated with a susceptibility to schizophrenia. Alternate splicing of this gene results in multiple transcript variants. A pseudogene of this gene is found on chromosome 22.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null females display impaired prepulse inhibition and reduced exploration in new environments. Homozygous null males display normal prepulse inhibition and only a slight decrease in exploration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A T 15: 60,920,127 Y217* probably null Het
Abca2 A T 2: 25,436,736 I567F probably benign Het
Acss2 T A 2: 155,549,178 probably null Het
Atxn7l2 C A 3: 108,204,811 A320S probably damaging Het
Bfsp1 C T 2: 143,827,459 G400D probably benign Het
Ces5a G T 8: 93,525,667 A199D probably damaging Het
Chd2 A T 7: 73,484,602 probably null Het
Crebbp A G 16: 4,087,742 V1705A probably damaging Het
Cyp2j8 T A 4: 96,507,214 Q58L probably benign Het
Dlec1 T A 9: 119,142,968 I1379N probably damaging Het
Dnah9 T C 11: 66,126,601 H593R probably benign Het
Ep300 T A 15: 81,611,472 C412S probably benign Het
Fam110a A G 2: 151,970,041 S270P probably damaging Het
Gcc2 A G 10: 58,294,821 T1412A probably damaging Het
Gm4788 T A 1: 139,774,598 probably null Het
Helz2 T C 2: 181,232,656 E2015G probably benign Het
Hormad1 T C 3: 95,562,559 V39A probably damaging Het
Igf2 G T 7: 142,653,855 H168Q probably damaging Het
Il18rap A G 1: 40,531,566 T223A probably benign Het
Itpr2 T C 6: 146,144,149 E2573G probably damaging Het
Jcad T A 18: 4,674,896 V886E probably benign Het
Klra1 T C 6: 130,380,629 R12G probably damaging Het
Lamb1 A G 12: 31,318,614 I1248V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk7 C T 11: 61,490,381 R465Q possibly damaging Het
Mogs T C 6: 83,118,212 V670A possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Ninl A T 2: 150,940,724 I1182N probably damaging Het
Nup160 A G 2: 90,679,770 probably null Het
Nynrin A G 14: 55,864,226 R451G probably benign Het
Olfr1126 A G 2: 87,457,450 D95G probably benign Het
Olfr190 T C 16: 59,074,661 I140V probably benign Het
Osbp A G 19: 11,970,721 T131A probably damaging Het
Pcdhga12 A C 18: 37,768,503 D796A possibly damaging Het
Pcdhgb8 G A 18: 37,762,236 V120I probably benign Het
Pdgfb A T 15: 79,997,668 V213E probably benign Het
Phldb2 T C 16: 45,763,097 M1013V probably benign Het
Pnmal1 A G 7: 16,961,095 S292G probably benign Het
Prrt4 A G 6: 29,177,183 S196P probably benign Het
Rap1gds1 T C 3: 138,955,375 M463V possibly damaging Het
Tmprss11g A T 5: 86,498,533 S58R probably damaging Het
Traf3 C A 12: 111,255,361 Q319K probably benign Het
Trappc8 C T 18: 20,873,920 V194M probably damaging Het
Tyw1 A G 5: 130,268,088 K182R probably damaging Het
Usp48 A G 4: 137,623,378 T585A probably benign Het
Xkr6 G T 14: 63,819,032 V387L probably benign Het
Yod1 T C 1: 130,719,006 W207R probably damaging Het
Zfp827 A G 8: 79,179,016 E874G probably damaging Het
Zfy1 T A Y: 726,531 K411N possibly damaging Het
Other mutations in Zdhhc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Zdhhc8 APN 16 18225196 missense possibly damaging 0.66
IGL01994:Zdhhc8 APN 16 18227772 unclassified probably benign
IGL02102:Zdhhc8 APN 16 18225199 missense possibly damaging 0.95
IGL02706:Zdhhc8 APN 16 18224894 missense probably damaging 1.00
IGL03287:Zdhhc8 APN 16 18225100 missense probably benign 0.01
IGL03296:Zdhhc8 APN 16 18226723 missense possibly damaging 0.94
R0066:Zdhhc8 UTSW 16 18225200 missense probably benign 0.00
R0066:Zdhhc8 UTSW 16 18225200 missense probably benign 0.00
R0491:Zdhhc8 UTSW 16 18228390 missense probably damaging 0.99
R0838:Zdhhc8 UTSW 16 18224566 missense probably damaging 0.99
R1567:Zdhhc8 UTSW 16 18227120 missense probably benign 0.36
R2057:Zdhhc8 UTSW 16 18228346 missense probably damaging 1.00
R3913:Zdhhc8 UTSW 16 18226723 missense possibly damaging 0.94
R4690:Zdhhc8 UTSW 16 18226741 missense probably damaging 0.96
R4902:Zdhhc8 UTSW 16 18227166 missense probably benign
R5111:Zdhhc8 UTSW 16 18226748 missense probably benign 0.00
R6111:Zdhhc8 UTSW 16 18224898 missense probably damaging 1.00
R6152:Zdhhc8 UTSW 16 18223338 missense possibly damaging 0.90
R7296:Zdhhc8 UTSW 16 18234926 missense probably benign 0.00
R7450:Zdhhc8 UTSW 16 18225171 missense probably benign 0.00
R7540:Zdhhc8 UTSW 16 18227810 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGAAGTCATCCTCCTTGTC -3'
(R):5'- GCCCAGAAGCATACATATGGC -3'

Sequencing Primer
(F):5'- CGCTGGACATCAGGACCAGTAG -3'
(R):5'- AGCATACATATGGCTGCGTC -3'
Posted On2016-12-20