Incidental Mutation 'R5825:Zfy1'
ID450152
Institutional Source Beutler Lab
Gene Symbol Zfy1
Ensembl Gene ENSMUSG00000053211
Gene Namezinc finger protein 1, Y-linked
SynonymsZfy-1
MMRRC Submission 044053-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.047) question?
Stock #R5825 (G1)
Quality Score222
Status Not validated
ChromosomeY
Chromosomal Location725128-797409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 726531 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 411 (K411N)
Ref Sequence ENSEMBL: ENSMUSP00000140600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065545] [ENSMUST00000189888]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065545
AA Change: K411N

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000069364
Gene: ENSMUSG00000053211
AA Change: K411N

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Zfx_Zfy_act 68 388 1.1e-109 PFAM
ZnF_C2H2 403 425 1.95e-3 SMART
ZnF_C2H2 434 456 1.26e-2 SMART
ZnF_C2H2 466 488 1.05e1 SMART
ZnF_C2H2 497 520 1.41e0 SMART
ZnF_C2H2 526 548 3.69e-4 SMART
ZnF_C2H2 554 577 3.63e-3 SMART
ZnF_C2H2 583 605 8.98e0 SMART
ZnF_C2H2 611 634 3.58e-2 SMART
ZnF_C2H2 640 662 2.95e-3 SMART
ZnF_C2H2 668 691 3.47e0 SMART
ZnF_C2H2 697 719 1.45e-2 SMART
ZnF_C2H2 725 748 1.2e-3 SMART
ZnF_C2H2 754 776 5.81e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000189888
AA Change: K411N

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140600
Gene: ENSMUSG00000053211
AA Change: K411N

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Zfx_Zfy_act 67 388 1.2e-141 PFAM
ZnF_C2H2 403 425 1.95e-3 SMART
ZnF_C2H2 434 456 1.26e-2 SMART
ZnF_C2H2 466 488 1.05e1 SMART
ZnF_C2H2 497 520 1.41e0 SMART
ZnF_C2H2 526 548 3.69e-4 SMART
ZnF_C2H2 554 577 3.63e-3 SMART
ZnF_C2H2 583 605 8.98e0 SMART
ZnF_C2H2 611 634 3.58e-2 SMART
ZnF_C2H2 640 662 2.95e-3 SMART
ZnF_C2H2 668 691 3.47e0 SMART
ZnF_C2H2 697 719 1.45e-2 SMART
ZnF_C2H2 725 748 1.2e-3 SMART
ZnF_C2H2 754 776 5.81e-2 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 95.3%
  • 20x: 83.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A T 15: 60,920,127 Y217* probably null Het
Abca2 A T 2: 25,436,736 I567F probably benign Het
Acss2 T A 2: 155,549,178 probably null Het
Atxn7l2 C A 3: 108,204,811 A320S probably damaging Het
Bfsp1 C T 2: 143,827,459 G400D probably benign Het
Ces5a G T 8: 93,525,667 A199D probably damaging Het
Chd2 A T 7: 73,484,602 probably null Het
Crebbp A G 16: 4,087,742 V1705A probably damaging Het
Cyp2j8 T A 4: 96,507,214 Q58L probably benign Het
Dlec1 T A 9: 119,142,968 I1379N probably damaging Het
Dnah9 T C 11: 66,126,601 H593R probably benign Het
Ep300 T A 15: 81,611,472 C412S probably benign Het
Fam110a A G 2: 151,970,041 S270P probably damaging Het
Gcc2 A G 10: 58,294,821 T1412A probably damaging Het
Gm4788 T A 1: 139,774,598 probably null Het
Helz2 T C 2: 181,232,656 E2015G probably benign Het
Hormad1 T C 3: 95,562,559 V39A probably damaging Het
Igf2 G T 7: 142,653,855 H168Q probably damaging Het
Il18rap A G 1: 40,531,566 T223A probably benign Het
Itpr2 T C 6: 146,144,149 E2573G probably damaging Het
Jcad T A 18: 4,674,896 V886E probably benign Het
Klra1 T C 6: 130,380,629 R12G probably damaging Het
Lamb1 A G 12: 31,318,614 I1248V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk7 C T 11: 61,490,381 R465Q possibly damaging Het
Mogs T C 6: 83,118,212 V670A possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Ninl A T 2: 150,940,724 I1182N probably damaging Het
Nup160 A G 2: 90,679,770 probably null Het
Nynrin A G 14: 55,864,226 R451G probably benign Het
Olfr1126 A G 2: 87,457,450 D95G probably benign Het
Olfr190 T C 16: 59,074,661 I140V probably benign Het
Osbp A G 19: 11,970,721 T131A probably damaging Het
Pcdhga12 A C 18: 37,768,503 D796A possibly damaging Het
Pcdhgb8 G A 18: 37,762,236 V120I probably benign Het
Pdgfb A T 15: 79,997,668 V213E probably benign Het
Phldb2 T C 16: 45,763,097 M1013V probably benign Het
Pnmal1 A G 7: 16,961,095 S292G probably benign Het
Prrt4 A G 6: 29,177,183 S196P probably benign Het
Rap1gds1 T C 3: 138,955,375 M463V possibly damaging Het
Tmprss11g A T 5: 86,498,533 S58R probably damaging Het
Traf3 C A 12: 111,255,361 Q319K probably benign Het
Trappc8 C T 18: 20,873,920 V194M probably damaging Het
Tyw1 A G 5: 130,268,088 K182R probably damaging Het
Usp48 A G 4: 137,623,378 T585A probably benign Het
Xkr6 G T 14: 63,819,032 V387L probably benign Het
Yod1 T C 1: 130,719,006 W207R probably damaging Het
Zdhhc8 T C 16: 18,228,674 S63G probably null Het
Zfp827 A G 8: 79,179,016 E874G probably damaging Het
Other mutations in Zfy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0149:Zfy1 UTSW Y 726121 missense possibly damaging 0.95
R0361:Zfy1 UTSW Y 726121 missense possibly damaging 0.95
R0529:Zfy1 UTSW Y 726040 missense probably damaging 1.00
R0837:Zfy1 UTSW Y 725850 nonsense probably null
R0945:Zfy1 UTSW Y 725983 missense probably damaging 0.98
R1163:Zfy1 UTSW Y 725611 missense probably damaging 0.98
R1394:Zfy1 UTSW Y 725957 missense possibly damaging 0.79
R1806:Zfy1 UTSW Y 725620 missense possibly damaging 0.88
R1928:Zfy1 UTSW Y 729733 missense unknown
R2374:Zfy1 UTSW Y 726391 missense probably damaging 0.99
R2374:Zfy1 UTSW Y 726392 missense possibly damaging 0.77
R2889:Zfy1 UTSW Y 726307 missense possibly damaging 0.95
R2980:Zfy1 UTSW Y 739054 missense unknown
R3437:Zfy1 UTSW Y 726357 missense possibly damaging 0.82
R4454:Zfy1 UTSW Y 725518 missense possibly damaging 0.86
R4529:Zfy1 UTSW Y 726511 missense possibly damaging 0.93
R4656:Zfy1 UTSW Y 729626 missense unknown
R5049:Zfy1 UTSW Y 726004 missense possibly damaging 0.93
R5087:Zfy1 UTSW Y 732964 missense unknown
R5347:Zfy1 UTSW Y 725950 missense possibly damaging 0.90
R5428:Zfy1 UTSW Y 726205 missense possibly damaging 0.95
R6256:Zfy1 UTSW Y 738765 missense unknown
R7065:Zfy1 UTSW Y 725428 missense probably benign 0.33
R7134:Zfy1 UTSW Y 725788 missense probably damaging 0.99
R7185:Zfy1 UTSW Y 725464 missense possibly damaging 0.53
R7358:Zfy1 UTSW Y 735141 missense unknown
R7513:Zfy1 UTSW Y 759852 missense unknown
R7747:Zfy1 UTSW Y 725496 nonsense probably null
R7900:Zfy1 UTSW Y 725519 missense possibly damaging 0.53
R8052:Zfy1 UTSW Y 726004 missense possibly damaging 0.93
R8377:Zfy1 UTSW Y 725723 missense possibly damaging 0.90
R8795:Zfy1 UTSW Y 738945 missense unknown
R8854:Zfy1 UTSW Y 726501 missense possibly damaging 0.71
R8936:Zfy1 UTSW Y 738726 missense unknown
Predicted Primers PCR Primer
(F):5'- GAAAGATTCTTCCTACAGTCATCAC -3'
(R):5'- GGCCTCTAATGTGATAAAGCTTC -3'

Sequencing Primer
(F):5'- ATTCTTCCTACAGTCATCACATTCAG -3'
(R):5'- AATCCAATCATAGTGAATCAGGTTC -3'
Posted On2016-12-20