Incidental Mutation 'R5826:Usp37'
ID450153
Institutional Source Beutler Lab
Gene Symbol Usp37
Ensembl Gene ENSMUSG00000033364
Gene Nameubiquitin specific peptidase 37
SynonymsC330008N13Rik, 4932415L06Rik
MMRRC Submission 043217-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5826 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location74435511-74544284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74470626 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 461 (N461K)
Ref Sequence ENSEMBL: ENSMUSP00000140670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044260] [ENSMUST00000189257]
Predicted Effect probably benign
Transcript: ENSMUST00000044260
AA Change: N461K

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000035445
Gene: ENSMUSG00000033364
AA Change: N461K

DomainStartEndE-ValueType
Pfam:UCH_N 1 105 5.1e-47 PFAM
low complexity region 182 200 N/A INTRINSIC
Pfam:UCH_1 341 645 3.4e-16 PFAM
UIM 704 723 1.33e1 SMART
UIM 806 825 1.04e-1 SMART
UIM 828 847 2.11e-2 SMART
low complexity region 893 909 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188012
Predicted Effect probably damaging
Transcript: ENSMUST00000189257
AA Change: N461K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140670
Gene: ENSMUSG00000033364
AA Change: N461K

DomainStartEndE-ValueType
PDB:3U12|B 4 125 2e-71 PDB
low complexity region 182 200 N/A INTRINSIC
Pfam:UCH_1 341 608 4.3e-19 PFAM
low complexity region 628 646 N/A INTRINSIC
UIM 704 723 1.33e1 SMART
UIM 806 825 1.04e-1 SMART
UIM 828 847 2.11e-2 SMART
low complexity region 893 909 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191058
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit complete embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,065,314 R838I possibly damaging Het
Abca13 A G 11: 9,682,056 H4992R probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Akr1c20 T C 13: 4,510,223 E152G probably damaging Het
Ano4 T A 10: 88,952,327 D877V probably damaging Het
Asb18 A C 1: 90,014,538 S14A probably damaging Het
Atrnl1 T A 19: 57,630,292 Y147* probably null Het
Cbfa2t2 A G 2: 154,500,455 I30M possibly damaging Het
Cpd A T 11: 76,784,416 L1293* probably null Het
Csmd2 T C 4: 128,519,199 probably null Het
Cst9 G A 2: 148,838,473 V120I possibly damaging Het
Ddah2 A G 17: 35,060,688 D128G probably damaging Het
Defb11 T C 8: 21,905,494 I56V probably benign Het
Dnah17 A T 11: 118,034,367 L3880Q probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dopey1 A G 9: 86,507,570 T508A possibly damaging Het
Ephb2 T A 4: 136,660,737 H685L probably damaging Het
Glrb T C 3: 80,845,142 Y387C probably damaging Het
Gucy2e A G 11: 69,236,033 S205P possibly damaging Het
Has2 T A 15: 56,668,102 I406F probably damaging Het
Hcrtr2 A C 9: 76,323,287 V73G probably benign Het
Hsd17b4 A T 18: 50,183,172 Q622L probably benign Het
Nlrp1b A T 11: 71,181,196 M607K probably benign Het
Nol6 T A 4: 41,122,158 D184V probably benign Het
Noxa1 T A 2: 25,086,241 Q345L probably damaging Het
Nudt6 T C 3: 37,419,468 T35A probably benign Het
Plcg2 T C 8: 117,610,844 V985A probably benign Het
Plxnc1 C T 10: 94,799,473 probably null Het
Prkdc G A 16: 15,734,098 R2056H probably benign Het
Ptpn4 A T 1: 119,684,516 I49N probably benign Het
Ralgapa1 T G 12: 55,677,113 S1543R probably damaging Het
Rnf135 A T 11: 80,199,086 N416I probably damaging Het
Scn5a A G 9: 119,521,333 L825P probably damaging Het
Sept11 A T 5: 93,139,450 N8I possibly damaging Het
Slc13a3 T C 2: 165,408,956 I456V probably benign Het
Slc16a3 A G 11: 120,956,930 T315A probably benign Het
Sun1 T G 5: 139,245,416 F657C probably damaging Het
Tmco3 T C 8: 13,310,314 S34P probably damaging Het
Tnrc18 G A 5: 142,773,747 P778L unknown Het
Ubxn4 A C 1: 128,266,321 K284T possibly damaging Het
Vmn2r106 A T 17: 20,278,871 F259L probably benign Het
Vmn2r73 T C 7: 85,875,748 D64G possibly damaging Het
Other mutations in Usp37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Usp37 APN 1 74490154 missense probably benign 0.05
IGL00961:Usp37 APN 1 74490155 missense probably benign
IGL01089:Usp37 APN 1 74493046 nonsense probably null
IGL01348:Usp37 APN 1 74461702 missense probably damaging 0.98
IGL01609:Usp37 APN 1 74475040 missense probably benign 0.02
PIT4544001:Usp37 UTSW 1 74470579 missense possibly damaging 0.65
R0331:Usp37 UTSW 1 74454064 nonsense probably null
R0332:Usp37 UTSW 1 74495710 missense possibly damaging 0.47
R0418:Usp37 UTSW 1 74490107 missense probably benign 0.01
R0456:Usp37 UTSW 1 74468348 missense probably damaging 1.00
R1605:Usp37 UTSW 1 74493004 missense possibly damaging 0.59
R1756:Usp37 UTSW 1 74479655 missense probably benign 0.20
R1971:Usp37 UTSW 1 74439968 nonsense probably null
R2061:Usp37 UTSW 1 74468272 missense probably damaging 1.00
R2130:Usp37 UTSW 1 74461656 missense probably damaging 1.00
R2215:Usp37 UTSW 1 74444526 missense probably damaging 1.00
R2867:Usp37 UTSW 1 74450532 missense probably damaging 1.00
R2867:Usp37 UTSW 1 74450532 missense probably damaging 1.00
R3716:Usp37 UTSW 1 74492986 missense possibly damaging 0.93
R5077:Usp37 UTSW 1 74441561 missense probably damaging 0.99
R5635:Usp37 UTSW 1 74495811 start gained probably benign
R5933:Usp37 UTSW 1 74485982 missense probably damaging 0.98
R6048:Usp37 UTSW 1 74478136 splice site probably null
R6169:Usp37 UTSW 1 74495751 missense probably damaging 0.99
R6193:Usp37 UTSW 1 74492928 missense probably damaging 1.00
R6235:Usp37 UTSW 1 74475133 nonsense probably null
R6361:Usp37 UTSW 1 74453893 missense probably benign 0.06
R6572:Usp37 UTSW 1 74495782 missense possibly damaging 0.95
R6759:Usp37 UTSW 1 74495749 nonsense probably null
R6997:Usp37 UTSW 1 74453959 missense probably benign 0.01
R7471:Usp37 UTSW 1 74495628 critical splice donor site probably null
R7632:Usp37 UTSW 1 74468374 missense probably benign 0.04
R7691:Usp37 UTSW 1 74486760 frame shift probably null
RF017:Usp37 UTSW 1 74470690 missense probably damaging 1.00
X0058:Usp37 UTSW 1 74453923 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTTACACAGTTAAGGCTG -3'
(R):5'- CAGGTACCTTTCGACTTCTAGGTG -3'

Sequencing Primer
(F):5'- CACAGTTAAGGCTGTTTCAAAATCC -3'
(R):5'- TGAATCACGGTTGTATAAGACACAG -3'
Posted On2016-12-20