Incidental Mutation 'R5826:Asb18'
ID450154
Institutional Source Beutler Lab
Gene Symbol Asb18
Ensembl Gene ENSMUSG00000067081
Gene Nameankyrin repeat and SOCS box-containing 18
Synonyms
MMRRC Submission 043217-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5826 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location89950220-90014666 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 90014538 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 14 (S14A)
Ref Sequence ENSEMBL: ENSMUSP00000117767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086882] [ENSMUST00000097656] [ENSMUST00000151330] [ENSMUST00000154228]
Predicted Effect probably damaging
Transcript: ENSMUST00000086882
AA Change: S14A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084095
Gene: ENSMUSG00000067081
AA Change: S14A

DomainStartEndE-ValueType
Blast:ANK 15 44 3e-8 BLAST
ANK 119 148 5.32e-5 SMART
ANK 151 180 1.99e-4 SMART
ANK 184 213 3.26e2 SMART
ANK 218 247 3.95e1 SMART
ANK 251 289 1.96e3 SMART
ANK 293 322 6.61e-1 SMART
Blast:ANK 329 365 1e-12 BLAST
SOCS_box 422 461 4.5e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000097656
AA Change: S14A
SMART Domains Protein: ENSMUSP00000095261
Gene: ENSMUSG00000067081
AA Change: S14A

DomainStartEndE-ValueType
Blast:ANK 15 44 1e-8 BLAST
SOCS_box 158 197 4.5e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151330
AA Change: S14A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117836
Gene: ENSMUSG00000067081
AA Change: S14A

DomainStartEndE-ValueType
Blast:ANK 15 44 1e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000154228
AA Change: S14A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117767
Gene: ENSMUSG00000067081
AA Change: S14A

DomainStartEndE-ValueType
Blast:ANK 15 44 9e-9 BLAST
ANK 78 107 5.32e-5 SMART
ANK 110 139 1.99e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and a SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,065,314 R838I possibly damaging Het
Abca13 A G 11: 9,682,056 H4992R probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Akr1c20 T C 13: 4,510,223 E152G probably damaging Het
Ano4 T A 10: 88,952,327 D877V probably damaging Het
Atrnl1 T A 19: 57,630,292 Y147* probably null Het
Cbfa2t2 A G 2: 154,500,455 I30M possibly damaging Het
Cpd A T 11: 76,784,416 L1293* probably null Het
Csmd2 T C 4: 128,519,199 probably null Het
Cst9 G A 2: 148,838,473 V120I possibly damaging Het
Ddah2 A G 17: 35,060,688 D128G probably damaging Het
Defb11 T C 8: 21,905,494 I56V probably benign Het
Dnah17 A T 11: 118,034,367 L3880Q probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dopey1 A G 9: 86,507,570 T508A possibly damaging Het
Ephb2 T A 4: 136,660,737 H685L probably damaging Het
Glrb T C 3: 80,845,142 Y387C probably damaging Het
Gucy2e A G 11: 69,236,033 S205P possibly damaging Het
Has2 T A 15: 56,668,102 I406F probably damaging Het
Hcrtr2 A C 9: 76,323,287 V73G probably benign Het
Hsd17b4 A T 18: 50,183,172 Q622L probably benign Het
Nlrp1b A T 11: 71,181,196 M607K probably benign Het
Nol6 T A 4: 41,122,158 D184V probably benign Het
Noxa1 T A 2: 25,086,241 Q345L probably damaging Het
Nudt6 T C 3: 37,419,468 T35A probably benign Het
Plcg2 T C 8: 117,610,844 V985A probably benign Het
Plxnc1 C T 10: 94,799,473 probably null Het
Prkdc G A 16: 15,734,098 R2056H probably benign Het
Ptpn4 A T 1: 119,684,516 I49N probably benign Het
Ralgapa1 T G 12: 55,677,113 S1543R probably damaging Het
Rnf135 A T 11: 80,199,086 N416I probably damaging Het
Scn5a A G 9: 119,521,333 L825P probably damaging Het
Sept11 A T 5: 93,139,450 N8I possibly damaging Het
Slc13a3 T C 2: 165,408,956 I456V probably benign Het
Slc16a3 A G 11: 120,956,930 T315A probably benign Het
Sun1 T G 5: 139,245,416 F657C probably damaging Het
Tmco3 T C 8: 13,310,314 S34P probably damaging Het
Tnrc18 G A 5: 142,773,747 P778L unknown Het
Ubxn4 A C 1: 128,266,321 K284T possibly damaging Het
Usp37 A T 1: 74,470,626 N461K probably damaging Het
Vmn2r106 A T 17: 20,278,871 F259L probably benign Het
Vmn2r73 T C 7: 85,875,748 D64G possibly damaging Het
Other mutations in Asb18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Asb18 APN 1 89996241 missense probably benign 0.02
IGL01559:Asb18 APN 1 89954450 missense probably damaging 1.00
IGL02188:Asb18 APN 1 89996299 missense probably benign 0.08
IGL02378:Asb18 APN 1 89992988 missense probably damaging 1.00
IGL02543:Asb18 APN 1 90014391 missense probably damaging 0.99
IGL02828:Asb18 APN 1 89996210 critical splice donor site probably null
IGL02877:Asb18 APN 1 89952811 missense possibly damaging 0.65
IGL03290:Asb18 APN 1 90014574 missense probably damaging 1.00
R0560:Asb18 UTSW 1 90014528 missense probably damaging 1.00
R0671:Asb18 UTSW 1 89993171 missense probably damaging 1.00
R1468:Asb18 UTSW 1 89996283 missense probably damaging 1.00
R1468:Asb18 UTSW 1 89996283 missense probably damaging 1.00
R1510:Asb18 UTSW 1 89996254 missense possibly damaging 0.62
R1721:Asb18 UTSW 1 89968580 missense probably benign 0.36
R1793:Asb18 UTSW 1 90014555 missense probably damaging 1.00
R1863:Asb18 UTSW 1 90014382 missense probably benign 0.10
R2171:Asb18 UTSW 1 89968697 missense probably benign 0.01
R2348:Asb18 UTSW 1 90014534 missense probably damaging 0.99
R3052:Asb18 UTSW 1 89992985 missense probably damaging 1.00
R3053:Asb18 UTSW 1 89992985 missense probably damaging 1.00
R3427:Asb18 UTSW 1 89968593 missense probably damaging 0.99
R4094:Asb18 UTSW 1 90014425 missense probably damaging 1.00
R4105:Asb18 UTSW 1 89968521 missense possibly damaging 0.61
R4405:Asb18 UTSW 1 89968689 missense probably benign 0.00
R4815:Asb18 UTSW 1 90014425 missense probably damaging 1.00
R4992:Asb18 UTSW 1 89952863 missense probably benign 0.03
R5287:Asb18 UTSW 1 90014388 missense probably benign 0.01
R5403:Asb18 UTSW 1 90014388 missense probably benign 0.01
R5494:Asb18 UTSW 1 89954399 missense probably damaging 1.00
R5504:Asb18 UTSW 1 89993024 missense probably damaging 1.00
R5617:Asb18 UTSW 1 89954462 missense possibly damaging 0.90
R6369:Asb18 UTSW 1 90014471 missense probably damaging 0.99
R7474:Asb18 UTSW 1 89993033 missense possibly damaging 0.91
R7751:Asb18 UTSW 1 89968484 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCCCAGCATGCATTAGTAATTGG -3'
(R):5'- CAAGGTGAAAGCAGCGTGTC -3'

Sequencing Primer
(F):5'- GGCCTCCTGTGGTTACCTAG -3'
(R):5'- TGAAAGCAGCGTGTCCCTCC -3'
Posted On2016-12-20