Mutagenetix > Incidental Mutations

Incidental Mutation 'R5826:Cbfa2t2'

450159

Institutional Source

Beutler Lab

Gene Symbol

Cbfa2t2

Ensembl Gene

ENSMUSG00000038533

Gene Name

core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human)

Synonyms

Cbfa2t2h, MTGR1, C330013D05Rik

MMRRC Submission

043217-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.729) question?

Stock #

R5826 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

154436481-154539356 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 154500455 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 30 (I30M)

Ref Sequence

ENSEMBL: ENSMUSP00000043087 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045270] [ENSMUST00000099178] [ENSMUST00000109724] [ENSMUST00000109725]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045270
AA Change: I30M

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000043087
Gene: ENSMUSG00000038533
AA Change: I30M

Domain	Start	End	E-Value	Type
low complexity region	33	52	N/A	INTRINSIC
TAFH	106	196	1.06e-49	SMART
Pfam:NHR2	322	388	1.3e-40	PFAM
PDB:2KYG\|C	420	450	3e-7	PDB
Pfam:zf-MYND	498	534	1.4e-9	PFAM
low complexity region	573	588	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099178
AA Change: I30M

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000096782
Gene: ENSMUSG00000038533
AA Change: I30M

Domain	Start	End	E-Value	Type
low complexity region	33	52	N/A	INTRINSIC
TAFH	106	196	1.06e-49	SMART
Pfam:NHR2	322	388	4.4e-40	PFAM
low complexity region	402	419	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109724

SMART Domains

Protein: ENSMUSP00000105346
Gene: ENSMUSG00000038533

Domain	Start	End	E-Value	Type
TAFH	58	148	1.06e-49	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109725
AA Change: I30M

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000105347
Gene: ENSMUSG00000038533
AA Change: I30M

Domain	Start	End	E-Value	Type
low complexity region	33	52	N/A	INTRINSIC
TAFH	106	196	1.06e-49	SMART
Pfam:NHR2	322	388	1e-40	PFAM
Pfam:zf-MYND	497	533	3.3e-11	PFAM
low complexity region	572	587	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000155202
AA Change: I87M

SMART Domains

Protein: ENSMUSP00000116220
Gene: ENSMUSG00000038533
AA Change: I87M

Domain	Start	End	E-Value	Type
low complexity region	91	110	N/A	INTRINSIC
Pfam:TAFH	164	192	7.1e-9	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In acute myeloid leukemia, especially in the M2 subtype, the t(8;21)(q22;q22) translocation is one of the most frequent karyotypic abnormalities. The translocation produces a chimeric gene made up of the 5'-region of the RUNX1 (AML1) gene fused to the 3'-region of the CBFA2T1 (MTG8) gene. The chimeric protein is thought to associate with the nuclear corepressor/histone deacetylase complex to block hematopoietic differentiation. The protein encoded by this gene binds to the AML1-MTG8 complex and may be important in promoting leukemogenesis. Several transcript variants are thought to exist for this gene, but the full-length natures of only three have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele are smaller and show reduced numbers of intestinal goblet, Paneth and enteroendocrine cells, small intestine inflammation, and strain dependent postnatal lethality. Homozygotes for a different null allele are infertile due to defects in primordial germ cell maturation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	C	A	17: 33,065,314	R838I	possibly damaging	Het
Abca13	A	G	11: 9,682,056	H4992R	probably damaging	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Akr1c20	T	C	13: 4,510,223	E152G	probably damaging	Het
Ano4	T	A	10: 88,952,327	D877V	probably damaging	Het
Asb18	A	C	1: 90,014,538	S14A	probably damaging	Het
Atrnl1	T	A	19: 57,630,292	Y147*	probably null	Het
Cpd	A	T	11: 76,784,416	L1293*	probably null	Het
Csmd2	T	C	4: 128,519,199		probably null	Het
Cst9	G	A	2: 148,838,473	V120I	possibly damaging	Het
Ddah2	A	G	17: 35,060,688	D128G	probably damaging	Het
Defb11	T	C	8: 21,905,494	I56V	probably benign	Het
Dnah17	A	T	11: 118,034,367	L3880Q	probably damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Dopey1	A	G	9: 86,507,570	T508A	possibly damaging	Het
Ephb2	T	A	4: 136,660,737	H685L	probably damaging	Het
Glrb	T	C	3: 80,845,142	Y387C	probably damaging	Het
Gucy2e	A	G	11: 69,236,033	S205P	possibly damaging	Het
Has2	T	A	15: 56,668,102	I406F	probably damaging	Het
Hcrtr2	A	C	9: 76,323,287	V73G	probably benign	Het
Hsd17b4	A	T	18: 50,183,172	Q622L	probably benign	Het
Nlrp1b	A	T	11: 71,181,196	M607K	probably benign	Het
Nol6	T	A	4: 41,122,158	D184V	probably benign	Het
Noxa1	T	A	2: 25,086,241	Q345L	probably damaging	Het
Nudt6	T	C	3: 37,419,468	T35A	probably benign	Het
Plcg2	T	C	8: 117,610,844	V985A	probably benign	Het
Plxnc1	C	T	10: 94,799,473		probably null	Het
Prkdc	G	A	16: 15,734,098	R2056H	probably benign	Het
Ptpn4	A	T	1: 119,684,516	I49N	probably benign	Het
Ralgapa1	T	G	12: 55,677,113	S1543R	probably damaging	Het
Rnf135	A	T	11: 80,199,086	N416I	probably damaging	Het
Scn5a	A	G	9: 119,521,333	L825P	probably damaging	Het
Sept11	A	T	5: 93,139,450	N8I	possibly damaging	Het
Slc13a3	T	C	2: 165,408,956	I456V	probably benign	Het
Slc16a3	A	G	11: 120,956,930	T315A	probably benign	Het
Sun1	T	G	5: 139,245,416	F657C	probably damaging	Het
Tmco3	T	C	8: 13,310,314	S34P	probably damaging	Het
Tnrc18	G	A	5: 142,773,747	P778L	unknown	Het
Ubxn4	A	C	1: 128,266,321	K284T	possibly damaging	Het
Usp37	A	T	1: 74,470,626	N461K	probably damaging	Het
Vmn2r106	A	T	17: 20,278,871	F259L	probably benign	Het
Vmn2r73	T	C	7: 85,875,748	D64G	possibly damaging	Het

Other mutations in Cbfa2t2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00833:Cbfa2t2	APN	2	154528875	missense	probably damaging	1.00
IGL01913:Cbfa2t2	APN	2	154517773	missense	probably damaging	1.00
IGL02090:Cbfa2t2	APN	2	154531416	splice site	probably benign
IGL02850:Cbfa2t2	APN	2	154535170	missense	probably damaging	0.97
R0302:Cbfa2t2	UTSW	2	154534876	splice site	probably benign
R0356:Cbfa2t2	UTSW	2	154531349	missense	probably benign	0.03
R1218:Cbfa2t2	UTSW	2	154523919	missense	probably benign	0.43
R1571:Cbfa2t2	UTSW	2	154500427	missense	probably damaging	1.00
R1998:Cbfa2t2	UTSW	2	154504789	missense	probably damaging	1.00
R2016:Cbfa2t2	UTSW	2	154517807	missense	probably damaging	1.00
R2017:Cbfa2t2	UTSW	2	154517807	missense	probably damaging	1.00
R2056:Cbfa2t2	UTSW	2	154535157	missense	probably damaging	1.00
R3617:Cbfa2t2	UTSW	2	154436984	intron	probably benign
R4299:Cbfa2t2	UTSW	2	154523928	missense	probably damaging	1.00
R4746:Cbfa2t2	UTSW	2	154523925	missense	possibly damaging	0.94
R4969:Cbfa2t2	UTSW	2	154523980	missense	probably damaging	1.00
R5058:Cbfa2t2	UTSW	2	154504745	missense	probably damaging	1.00
R5109:Cbfa2t2	UTSW	2	154531373	missense	probably damaging	1.00
R5381:Cbfa2t2	UTSW	2	154523929	missense	probably damaging	1.00
R5573:Cbfa2t2	UTSW	2	154436862	intron	probably benign
R5808:Cbfa2t2	UTSW	2	154517826	unclassified	probably null
R5977:Cbfa2t2	UTSW	2	154517777	missense	probably damaging	1.00
R6052:Cbfa2t2	UTSW	2	154510581	missense	probably damaging	1.00
R6842:Cbfa2t2	UTSW	2	154524045	missense	probably benign	0.02
R6923:Cbfa2t2	UTSW	2	154534983	missense	probably damaging	1.00
R7269:Cbfa2t2	UTSW	2	154515975	missense	probably benign	0.37
R7318:Cbfa2t2	UTSW	2	154500454	missense	probably benign	0.01
R7622:Cbfa2t2	UTSW	2	154500445	missense	possibly damaging	0.90
R8030:Cbfa2t2	UTSW	2	154515896	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GGACATGAACCCTTGGAAGC -3'
(R):5'- TACAGGAATGCATTGCTATACCTC -3'

Sequencing Primer
(F):5'- ATGAACCCTTGGAAGCTTCATC -3'
(R):5'- GCATTGCTATACCTCAATGTGTG -3'

Posted On

2016-12-20