Incidental Mutation 'R5826:Glrb'
ID450163
Institutional Source Beutler Lab
Gene Symbol Glrb
Ensembl Gene ENSMUSG00000028020
Gene Nameglycine receptor, beta subunit
Synonyms
MMRRC Submission 043217-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5826 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location80843599-80913660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80845142 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 387 (Y387C)
Ref Sequence ENSEMBL: ENSMUSP00000142306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029654] [ENSMUST00000135043] [ENSMUST00000194085]
Predicted Effect probably damaging
Transcript: ENSMUST00000029654
AA Change: Y438C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029654
Gene: ENSMUSG00000028020
AA Change: Y438C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
Pfam:Neur_chan_LBD 56 266 6.9e-55 PFAM
Pfam:Neur_chan_memb 273 492 4.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135043
SMART Domains Protein: ENSMUSP00000116604
Gene: ENSMUSG00000028020

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194085
AA Change: Y387C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142306
Gene: ENSMUSG00000028020
AA Change: Y387C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
Pfam:Neur_chan_LBD 56 264 6.9e-55 PFAM
Pfam:Neur_chan_memb 248 441 1.1e-22 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the beta subunit of the glycine receptor, which is a pentamer composed of alpha and beta subunits. The receptor functions as a neurotransmitter-gated ion channel, which produces hyperpolarization via increased chloride conductance due to the binding of glycine to the receptor. This gene is transcribed throughout the central nervous system of neonatal and adult mice. In humans, mutations in this gene cause startle disease, also known as hereditary hyperekplexia or congenital stiff-person syndrome, a disease characterized by muscular rigidity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mutations in this gene result in a neurological disorder and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,065,314 R838I possibly damaging Het
Abca13 A G 11: 9,682,056 H4992R probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Akr1c20 T C 13: 4,510,223 E152G probably damaging Het
Ano4 T A 10: 88,952,327 D877V probably damaging Het
Asb18 A C 1: 90,014,538 S14A probably damaging Het
Atrnl1 T A 19: 57,630,292 Y147* probably null Het
Cbfa2t2 A G 2: 154,500,455 I30M possibly damaging Het
Cpd A T 11: 76,784,416 L1293* probably null Het
Csmd2 T C 4: 128,519,199 probably null Het
Cst9 G A 2: 148,838,473 V120I possibly damaging Het
Ddah2 A G 17: 35,060,688 D128G probably damaging Het
Defb11 T C 8: 21,905,494 I56V probably benign Het
Dnah17 A T 11: 118,034,367 L3880Q probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dopey1 A G 9: 86,507,570 T508A possibly damaging Het
Ephb2 T A 4: 136,660,737 H685L probably damaging Het
Gucy2e A G 11: 69,236,033 S205P possibly damaging Het
Has2 T A 15: 56,668,102 I406F probably damaging Het
Hcrtr2 A C 9: 76,323,287 V73G probably benign Het
Hsd17b4 A T 18: 50,183,172 Q622L probably benign Het
Nlrp1b A T 11: 71,181,196 M607K probably benign Het
Nol6 T A 4: 41,122,158 D184V probably benign Het
Noxa1 T A 2: 25,086,241 Q345L probably damaging Het
Nudt6 T C 3: 37,419,468 T35A probably benign Het
Plcg2 T C 8: 117,610,844 V985A probably benign Het
Plxnc1 C T 10: 94,799,473 probably null Het
Prkdc G A 16: 15,734,098 R2056H probably benign Het
Ptpn4 A T 1: 119,684,516 I49N probably benign Het
Ralgapa1 T G 12: 55,677,113 S1543R probably damaging Het
Rnf135 A T 11: 80,199,086 N416I probably damaging Het
Scn5a A G 9: 119,521,333 L825P probably damaging Het
Sept11 A T 5: 93,139,450 N8I possibly damaging Het
Slc13a3 T C 2: 165,408,956 I456V probably benign Het
Slc16a3 A G 11: 120,956,930 T315A probably benign Het
Sun1 T G 5: 139,245,416 F657C probably damaging Het
Tmco3 T C 8: 13,310,314 S34P probably damaging Het
Tnrc18 G A 5: 142,773,747 P778L unknown Het
Ubxn4 A C 1: 128,266,321 K284T possibly damaging Het
Usp37 A T 1: 74,470,626 N461K probably damaging Het
Vmn2r106 A T 17: 20,278,871 F259L probably benign Het
Vmn2r73 T C 7: 85,875,748 D64G possibly damaging Het
Other mutations in Glrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Glrb APN 3 80861955 missense probably damaging 1.00
IGL00850:Glrb APN 3 80861781 missense probably damaging 1.00
IGL01970:Glrb APN 3 80861925 missense possibly damaging 0.92
IGL02023:Glrb APN 3 80850955 missense probably benign 0.22
IGL02494:Glrb APN 3 80845232 missense probably benign 0.01
IGL02703:Glrb APN 3 80850993 missense probably benign 0.19
I1329:Glrb UTSW 3 80862074 missense probably damaging 1.00
R0003:Glrb UTSW 3 80855914 missense probably damaging 1.00
R0010:Glrb UTSW 3 80860315 splice site probably benign
R0010:Glrb UTSW 3 80860315 splice site probably benign
R0743:Glrb UTSW 3 80879680 missense probably damaging 1.00
R1367:Glrb UTSW 3 80862004 missense probably damaging 1.00
R1491:Glrb UTSW 3 80911975 missense possibly damaging 0.81
R1699:Glrb UTSW 3 80861774 missense probably damaging 1.00
R1791:Glrb UTSW 3 80860175 missense probably damaging 1.00
R1802:Glrb UTSW 3 80861957 missense probably damaging 1.00
R2420:Glrb UTSW 3 80860235 missense probably damaging 0.97
R2422:Glrb UTSW 3 80860235 missense probably damaging 0.97
R2517:Glrb UTSW 3 80861747 missense probably damaging 1.00
R3612:Glrb UTSW 3 80862030 missense possibly damaging 0.89
R4287:Glrb UTSW 3 80845232 missense possibly damaging 0.84
R4382:Glrb UTSW 3 80879639 missense probably damaging 1.00
R4546:Glrb UTSW 3 80879686 missense probably damaging 0.99
R4874:Glrb UTSW 3 80851042 missense possibly damaging 0.84
R5816:Glrb UTSW 3 80861979 missense probably damaging 1.00
R6711:Glrb UTSW 3 80844974 missense probably benign 0.02
R7738:Glrb UTSW 3 80860184 missense probably damaging 0.98
Z1088:Glrb UTSW 3 80845234 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GGTGCTGTATTTCATACAAAGGG -3'
(R):5'- TGGGCAAAGTATCAGAGCCTTC -3'

Sequencing Primer
(F):5'- GCTGTATTTCATACAAAGGGAAATGG -3'
(R):5'- GCAAAGTATCAGAGCCTTCTTAAATG -3'
Posted On2016-12-20