Incidental Mutation 'R5826:Vmn2r73'
ID450172
Institutional Source Beutler Lab
Gene Symbol Vmn2r73
Ensembl Gene ENSMUSG00000070458
Gene Namevomeronasal 2, receptor 73
SynonymsEG620928
MMRRC Submission 043217-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R5826 (G1)
Quality Score220
Status Not validated
Chromosome7
Chromosomal Location85857547-85875938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85875748 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 64 (D64G)
Ref Sequence ENSEMBL: ENSMUSP00000076687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077478]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077478
AA Change: D64G

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000076687
Gene: ENSMUSG00000070458
AA Change: D64G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 465 1.4e-30 PFAM
Pfam:NCD3G 508 560 5.9e-21 PFAM
Pfam:7tm_3 590 827 4.4e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,065,314 R838I possibly damaging Het
Abca13 A G 11: 9,682,056 H4992R probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Akr1c20 T C 13: 4,510,223 E152G probably damaging Het
Ano4 T A 10: 88,952,327 D877V probably damaging Het
Asb18 A C 1: 90,014,538 S14A probably damaging Het
Atrnl1 T A 19: 57,630,292 Y147* probably null Het
Cbfa2t2 A G 2: 154,500,455 I30M possibly damaging Het
Cpd A T 11: 76,784,416 L1293* probably null Het
Csmd2 T C 4: 128,519,199 probably null Het
Cst9 G A 2: 148,838,473 V120I possibly damaging Het
Ddah2 A G 17: 35,060,688 D128G probably damaging Het
Defb11 T C 8: 21,905,494 I56V probably benign Het
Dnah17 A T 11: 118,034,367 L3880Q probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dopey1 A G 9: 86,507,570 T508A possibly damaging Het
Ephb2 T A 4: 136,660,737 H685L probably damaging Het
Glrb T C 3: 80,845,142 Y387C probably damaging Het
Gucy2e A G 11: 69,236,033 S205P possibly damaging Het
Has2 T A 15: 56,668,102 I406F probably damaging Het
Hcrtr2 A C 9: 76,323,287 V73G probably benign Het
Hsd17b4 A T 18: 50,183,172 Q622L probably benign Het
Nlrp1b A T 11: 71,181,196 M607K probably benign Het
Nol6 T A 4: 41,122,158 D184V probably benign Het
Noxa1 T A 2: 25,086,241 Q345L probably damaging Het
Nudt6 T C 3: 37,419,468 T35A probably benign Het
Plcg2 T C 8: 117,610,844 V985A probably benign Het
Plxnc1 C T 10: 94,799,473 probably null Het
Prkdc G A 16: 15,734,098 R2056H probably benign Het
Ptpn4 A T 1: 119,684,516 I49N probably benign Het
Ralgapa1 T G 12: 55,677,113 S1543R probably damaging Het
Rnf135 A T 11: 80,199,086 N416I probably damaging Het
Scn5a A G 9: 119,521,333 L825P probably damaging Het
Sept11 A T 5: 93,139,450 N8I possibly damaging Het
Slc13a3 T C 2: 165,408,956 I456V probably benign Het
Slc16a3 A G 11: 120,956,930 T315A probably benign Het
Sun1 T G 5: 139,245,416 F657C probably damaging Het
Tmco3 T C 8: 13,310,314 S34P probably damaging Het
Tnrc18 G A 5: 142,773,747 P778L unknown Het
Ubxn4 A C 1: 128,266,321 K284T possibly damaging Het
Usp37 A T 1: 74,470,626 N461K probably damaging Het
Vmn2r106 A T 17: 20,278,871 F259L probably benign Het
Other mutations in Vmn2r73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Vmn2r73 APN 7 85857587 missense probably benign
IGL01151:Vmn2r73 APN 7 85857878 missense probably damaging 0.99
IGL01408:Vmn2r73 APN 7 85872247 missense probably benign 0.45
IGL01505:Vmn2r73 APN 7 85858059 nonsense probably null
IGL01731:Vmn2r73 APN 7 85857549 makesense probably null
IGL01818:Vmn2r73 APN 7 85869901 splice site probably benign
IGL02236:Vmn2r73 APN 7 85872694 missense probably benign 0.00
IGL02265:Vmn2r73 APN 7 85871639 missense probably benign 0.02
IGL02266:Vmn2r73 APN 7 85875799 missense possibly damaging 0.52
IGL02276:Vmn2r73 APN 7 85869772 critical splice donor site probably null
IGL02284:Vmn2r73 APN 7 85857915 missense possibly damaging 0.92
IGL02380:Vmn2r73 APN 7 85858175 missense probably benign 0.00
IGL02466:Vmn2r73 APN 7 85872876 missense probably damaging 1.00
IGL03172:Vmn2r73 APN 7 85858287 missense probably benign 0.01
IGL03179:Vmn2r73 APN 7 85870260 missense probably benign 0.04
R0077:Vmn2r73 UTSW 7 85875867 missense probably benign 0.00
R0311:Vmn2r73 UTSW 7 85871789 missense probably benign
R0413:Vmn2r73 UTSW 7 85871879 missense possibly damaging 0.68
R0494:Vmn2r73 UTSW 7 85872932 missense probably benign
R1523:Vmn2r73 UTSW 7 85870278 missense probably benign 0.02
R1618:Vmn2r73 UTSW 7 85875912 nonsense probably null
R1667:Vmn2r73 UTSW 7 85857681 missense probably benign 0.00
R1728:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R1729:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R1747:Vmn2r73 UTSW 7 85858167 missense probably damaging 1.00
R1784:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R2152:Vmn2r73 UTSW 7 85857728 missense probably benign 0.03
R2395:Vmn2r73 UTSW 7 85857767 missense probably damaging 1.00
R2415:Vmn2r73 UTSW 7 85872223 missense probably damaging 1.00
R2926:Vmn2r73 UTSW 7 85871663 missense probably benign 0.17
R3719:Vmn2r73 UTSW 7 85870374 missense probably damaging 1.00
R3766:Vmn2r73 UTSW 7 85871990 missense probably benign
R3838:Vmn2r73 UTSW 7 85858050 missense probably benign 0.00
R3890:Vmn2r73 UTSW 7 85857936 missense probably benign
R4030:Vmn2r73 UTSW 7 85871836 missense possibly damaging 0.92
R4247:Vmn2r73 UTSW 7 85872675 missense probably damaging 0.99
R4409:Vmn2r73 UTSW 7 85871560 missense probably damaging 0.97
R4427:Vmn2r73 UTSW 7 85857773 missense probably damaging 1.00
R4430:Vmn2r73 UTSW 7 85870241 missense probably benign
R4552:Vmn2r73 UTSW 7 85875847 missense probably benign 0.12
R4779:Vmn2r73 UTSW 7 85871715 nonsense probably null
R4906:Vmn2r73 UTSW 7 85857621 missense probably damaging 0.99
R4942:Vmn2r73 UTSW 7 85870374 missense probably damaging 1.00
R5280:Vmn2r73 UTSW 7 85857947 missense probably damaging 0.98
R5344:Vmn2r73 UTSW 7 85875838 missense probably benign 0.00
R5478:Vmn2r73 UTSW 7 85869788 missense probably damaging 1.00
R5527:Vmn2r73 UTSW 7 85858367 missense possibly damaging 0.65
R5691:Vmn2r73 UTSW 7 85858091 missense probably damaging 1.00
R6018:Vmn2r73 UTSW 7 85872667 missense possibly damaging 0.48
R6082:Vmn2r73 UTSW 7 85858221 missense probably benign 0.00
R6111:Vmn2r73 UTSW 7 85871789 missense probably benign
R6233:Vmn2r73 UTSW 7 85869891 missense probably benign 0.00
R6278:Vmn2r73 UTSW 7 85872932 missense probably benign
R6283:Vmn2r73 UTSW 7 85871841 missense probably benign 0.00
R6307:Vmn2r73 UTSW 7 85857620 missense probably damaging 1.00
R6413:Vmn2r73 UTSW 7 85870336 nonsense probably null
R6782:Vmn2r73 UTSW 7 85870355 missense probably benign 0.00
R6884:Vmn2r73 UTSW 7 85858005 missense probably benign 0.05
R6921:Vmn2r73 UTSW 7 85858238 missense probably benign 0.27
R7169:Vmn2r73 UTSW 7 85858455 nonsense probably null
R7206:Vmn2r73 UTSW 7 85872867 missense probably benign 0.03
R7311:Vmn2r73 UTSW 7 85871984 missense possibly damaging 0.80
R7650:Vmn2r73 UTSW 7 85871939 missense probably benign
R7811:Vmn2r73 UTSW 7 85875748 missense possibly damaging 0.77
X0023:Vmn2r73 UTSW 7 85858456 missense probably benign 0.31
Z1176:Vmn2r73 UTSW 7 85871968 missense probably damaging 0.99
Z1177:Vmn2r73 UTSW 7 85872272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTCATTCATTCAGCATTTACC -3'
(R):5'- CAGGCAGATATCTTGTGGACAGG -3'

Sequencing Primer
(F):5'- CAGCATTTACCTAGAAATTGAAACTC -3'
(R):5'- TGTTCTCTTTGATCTTCATTTTCTGG -3'
Posted On2016-12-20