Incidental Mutation 'R5826:Defb11'
ID450174
Institutional Source Beutler Lab
Gene Symbol Defb11
Ensembl Gene ENSMUSG00000045337
Gene Namedefensin beta 11
SynonymsDefb8
MMRRC Submission 043217-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5826 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location21905376-21906412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21905494 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 56 (I56V)
Ref Sequence ENSEMBL: ENSMUSP00000053932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051965]
Predicted Effect probably benign
Transcript: ENSMUST00000051965
AA Change: I56V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000053932
Gene: ENSMUSG00000045337
AA Change: I56V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
DEFSN 37 67 3.54e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212313
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,065,314 R838I possibly damaging Het
Abca13 A G 11: 9,682,056 H4992R probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Akr1c20 T C 13: 4,510,223 E152G probably damaging Het
Ano4 T A 10: 88,952,327 D877V probably damaging Het
Asb18 A C 1: 90,014,538 S14A probably damaging Het
Atrnl1 T A 19: 57,630,292 Y147* probably null Het
Cbfa2t2 A G 2: 154,500,455 I30M possibly damaging Het
Cpd A T 11: 76,784,416 L1293* probably null Het
Csmd2 T C 4: 128,519,199 probably null Het
Cst9 G A 2: 148,838,473 V120I possibly damaging Het
Ddah2 A G 17: 35,060,688 D128G probably damaging Het
Dnah17 A T 11: 118,034,367 L3880Q probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dopey1 A G 9: 86,507,570 T508A possibly damaging Het
Ephb2 T A 4: 136,660,737 H685L probably damaging Het
Glrb T C 3: 80,845,142 Y387C probably damaging Het
Gucy2e A G 11: 69,236,033 S205P possibly damaging Het
Has2 T A 15: 56,668,102 I406F probably damaging Het
Hcrtr2 A C 9: 76,323,287 V73G probably benign Het
Hsd17b4 A T 18: 50,183,172 Q622L probably benign Het
Nlrp1b A T 11: 71,181,196 M607K probably benign Het
Nol6 T A 4: 41,122,158 D184V probably benign Het
Noxa1 T A 2: 25,086,241 Q345L probably damaging Het
Nudt6 T C 3: 37,419,468 T35A probably benign Het
Plcg2 T C 8: 117,610,844 V985A probably benign Het
Plxnc1 C T 10: 94,799,473 probably null Het
Prkdc G A 16: 15,734,098 R2056H probably benign Het
Ptpn4 A T 1: 119,684,516 I49N probably benign Het
Ralgapa1 T G 12: 55,677,113 S1543R probably damaging Het
Rnf135 A T 11: 80,199,086 N416I probably damaging Het
Scn5a A G 9: 119,521,333 L825P probably damaging Het
Sept11 A T 5: 93,139,450 N8I possibly damaging Het
Slc13a3 T C 2: 165,408,956 I456V probably benign Het
Slc16a3 A G 11: 120,956,930 T315A probably benign Het
Sun1 T G 5: 139,245,416 F657C probably damaging Het
Tmco3 T C 8: 13,310,314 S34P probably damaging Het
Tnrc18 G A 5: 142,773,747 P778L unknown Het
Ubxn4 A C 1: 128,266,321 K284T possibly damaging Het
Usp37 A T 1: 74,470,626 N461K probably damaging Het
Vmn2r106 A T 17: 20,278,871 F259L probably benign Het
Vmn2r73 T C 7: 85,875,748 D64G possibly damaging Het
Other mutations in Defb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Defb11 APN 8 21905494 missense probably benign 0.01
R2269:Defb11 UTSW 8 21905428 makesense probably null
R5067:Defb11 UTSW 8 21906336 missense probably damaging 0.96
R7252:Defb11 UTSW 8 21905457 missense probably benign 0.00
X0064:Defb11 UTSW 8 21906346 missense probably null 0.96
Z1177:Defb11 UTSW 8 21906346 missense probably null 0.96
Predicted Primers PCR Primer
(F):5'- AGCTTGGACATTAGCCTTGG -3'
(R):5'- AGGAGAAAATTGCCCCATGAAC -3'

Sequencing Primer
(F):5'- GCTTGGACATTAGCCTTGGATAATC -3'
(R):5'- TTGCCCCATGAACTTAGACATG -3'
Posted On2016-12-20