Incidental Mutation 'R5826:Ano4'
ID450179
Institutional Source Beutler Lab
Gene Symbol Ano4
Ensembl Gene ENSMUSG00000035189
Gene Nameanoctamin 4
SynonymsA330096O15Rik, Tmem16d
MMRRC Submission 043217-MU
Accession Numbers

Ncbi RefSeq: NM_178773.4; MGI: 2443344

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5826 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location88948994-89344762 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88952327 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 877 (D877V)
Ref Sequence ENSEMBL: ENSMUSP00000138325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182341] [ENSMUST00000182462] [ENSMUST00000182613] [ENSMUST00000182790]
Predicted Effect probably damaging
Transcript: ENSMUST00000182341
AA Change: D912V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138193
Gene: ENSMUSG00000035189
AA Change: D912V

DomainStartEndE-ValueType
Pfam:Anoctamin 339 922 4.8e-162 PFAM
low complexity region 932 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182462
Predicted Effect probably damaging
Transcript: ENSMUST00000182613
AA Change: D877V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138268
Gene: ENSMUSG00000035189
AA Change: D877V

DomainStartEndE-ValueType
Pfam:Anoctamin 304 887 3.6e-162 PFAM
low complexity region 897 910 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182790
AA Change: D877V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138325
Gene: ENSMUSG00000035189
AA Change: D877V

DomainStartEndE-ValueType
Pfam:Anoctamin 304 887 3.6e-162 PFAM
low complexity region 897 910 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,065,314 R838I possibly damaging Het
Abca13 A G 11: 9,682,056 H4992R probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Akr1c20 T C 13: 4,510,223 E152G probably damaging Het
Asb18 A C 1: 90,014,538 S14A probably damaging Het
Atrnl1 T A 19: 57,630,292 Y147* probably null Het
Cbfa2t2 A G 2: 154,500,455 I30M possibly damaging Het
Cpd A T 11: 76,784,416 L1293* probably null Het
Csmd2 T C 4: 128,519,199 probably null Het
Cst9 G A 2: 148,838,473 V120I possibly damaging Het
Ddah2 A G 17: 35,060,688 D128G probably damaging Het
Defb11 T C 8: 21,905,494 I56V probably benign Het
Dnah17 A T 11: 118,034,367 L3880Q probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dopey1 A G 9: 86,507,570 T508A possibly damaging Het
Ephb2 T A 4: 136,660,737 H685L probably damaging Het
Glrb T C 3: 80,845,142 Y387C probably damaging Het
Gucy2e A G 11: 69,236,033 S205P possibly damaging Het
Has2 T A 15: 56,668,102 I406F probably damaging Het
Hcrtr2 A C 9: 76,323,287 V73G probably benign Het
Hsd17b4 A T 18: 50,183,172 Q622L probably benign Het
Nlrp1b A T 11: 71,181,196 M607K probably benign Het
Nol6 T A 4: 41,122,158 D184V probably benign Het
Noxa1 T A 2: 25,086,241 Q345L probably damaging Het
Nudt6 T C 3: 37,419,468 T35A probably benign Het
Plcg2 T C 8: 117,610,844 V985A probably benign Het
Plxnc1 C T 10: 94,799,473 probably null Het
Prkdc G A 16: 15,734,098 R2056H probably benign Het
Ptpn4 A T 1: 119,684,516 I49N probably benign Het
Ralgapa1 T G 12: 55,677,113 S1543R probably damaging Het
Rnf135 A T 11: 80,199,086 N416I probably damaging Het
Scn5a A G 9: 119,521,333 L825P probably damaging Het
Sept11 A T 5: 93,139,450 N8I possibly damaging Het
Slc13a3 T C 2: 165,408,956 I456V probably benign Het
Slc16a3 A G 11: 120,956,930 T315A probably benign Het
Sun1 T G 5: 139,245,416 F657C probably damaging Het
Tmco3 T C 8: 13,310,314 S34P probably damaging Het
Tnrc18 G A 5: 142,773,747 P778L unknown Het
Ubxn4 A C 1: 128,266,321 K284T possibly damaging Het
Usp37 A T 1: 74,470,626 N461K probably damaging Het
Vmn2r106 A T 17: 20,278,871 F259L probably benign Het
Vmn2r73 T C 7: 85,875,748 D64G possibly damaging Het
Other mutations in Ano4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Ano4 APN 10 88954667 missense probably damaging 1.00
IGL00916:Ano4 APN 10 88998098 missense probably benign 0.01
IGL01010:Ano4 APN 10 88960600 missense probably benign 0.14
IGL01015:Ano4 APN 10 89035099 missense probably damaging 1.00
IGL01877:Ano4 APN 10 89025070 nonsense probably null 0.00
IGL02310:Ano4 APN 10 89023878 nonsense probably null
IGL02390:Ano4 APN 10 89024981 missense possibly damaging 0.88
IGL02560:Ano4 APN 10 88978741 nonsense probably null
Dwindle UTSW 10 88983778 missense probably damaging 0.98
P0017:Ano4 UTSW 10 88981190 nonsense probably null
PIT4486001:Ano4 UTSW 10 88993029 missense probably damaging 1.00
R0126:Ano4 UTSW 10 88952292 missense possibly damaging 0.73
R0380:Ano4 UTSW 10 88978813 missense possibly damaging 0.82
R0508:Ano4 UTSW 10 88980977 missense probably damaging 1.00
R0540:Ano4 UTSW 10 89023944 missense probably benign 0.00
R1802:Ano4 UTSW 10 88981016 missense probably damaging 1.00
R1864:Ano4 UTSW 10 88971391 missense probably damaging 1.00
R1871:Ano4 UTSW 10 88993027 missense probably damaging 1.00
R2829:Ano4 UTSW 10 89112939 missense possibly damaging 0.58
R2880:Ano4 UTSW 10 89112799 missense probably damaging 1.00
R3846:Ano4 UTSW 10 88995252 missense possibly damaging 0.93
R3904:Ano4 UTSW 10 89025005 missense probably damaging 1.00
R4006:Ano4 UTSW 10 89088263 missense probably benign 0.18
R4429:Ano4 UTSW 10 88992942 missense probably damaging 0.99
R4547:Ano4 UTSW 10 88981170 missense probably null
R4638:Ano4 UTSW 10 88954697 missense probably damaging 1.00
R4640:Ano4 UTSW 10 88954697 missense probably damaging 1.00
R4876:Ano4 UTSW 10 89112835 missense probably damaging 1.00
R5007:Ano4 UTSW 10 89112945 missense probably benign 0.26
R5104:Ano4 UTSW 10 89068112 missense possibly damaging 0.61
R5151:Ano4 UTSW 10 89112913 missense probably damaging 1.00
R5215:Ano4 UTSW 10 89317303 missense possibly damaging 0.86
R5396:Ano4 UTSW 10 89112840 missense probably damaging 1.00
R6018:Ano4 UTSW 10 89029266 missense probably benign 0.01
R6036:Ano4 UTSW 10 88982265 missense possibly damaging 0.95
R6036:Ano4 UTSW 10 88982265 missense possibly damaging 0.95
R6037:Ano4 UTSW 10 89317246 missense possibly damaging 0.93
R6037:Ano4 UTSW 10 89317246 missense possibly damaging 0.93
R6222:Ano4 UTSW 10 89027222 missense probably damaging 1.00
R6387:Ano4 UTSW 10 88971405 nonsense probably null
R6521:Ano4 UTSW 10 88983778 missense probably damaging 0.98
R6739:Ano4 UTSW 10 89027252 missense probably damaging 1.00
R6786:Ano4 UTSW 10 88992870 splice site probably null
R7035:Ano4 UTSW 10 88954711 missense probably damaging 1.00
R7523:Ano4 UTSW 10 88971395 nonsense probably null
R7715:Ano4 UTSW 10 88995311 missense probably damaging 0.99
R8005:Ano4 UTSW 10 88971321 missense probably benign 0.04
R8024:Ano4 UTSW 10 88971332 missense probably damaging 1.00
T0970:Ano4 UTSW 10 88981190 nonsense probably null
Z1176:Ano4 UTSW 10 89112945 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TGACCCTTGTTAGCAAACACTC -3'
(R):5'- TGGTCCTCCTCTCTAGATGGTG -3'

Sequencing Primer
(F):5'- TCTGCACCTGACCTGGATGTG -3'
(R):5'- TCCTCTCTAGATGGTGTCAACAAAC -3'
Posted On2016-12-20