Incidental Mutation 'R5826:Plxnc1'
ID450180
Institutional Source Beutler Lab
Gene Symbol Plxnc1
Ensembl Gene ENSMUSG00000074785
Gene Nameplexin C1
SynonymsCD232, vespr, 2510048K12Rik
MMRRC Submission 043217-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.645) question?
Stock #R5826 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location94790866-94944835 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 94799473 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099337]
Predicted Effect probably null
Transcript: ENSMUST00000099337
SMART Domains Protein: ENSMUSP00000096939
Gene: ENSMUSG00000074785

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Sema 87 431 5.5e-10 PFAM
PSI 454 507 5.28e-12 SMART
PSI 590 634 1.07e-3 SMART
Pfam:TIG 665 752 3.7e-9 PFAM
IPT 755 847 5.14e-7 SMART
IPT 849 954 1.8e-2 SMART
low complexity region 978 997 N/A INTRINSIC
Pfam:Plexin_cytopl 1018 1541 1.4e-199 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin family. Plexins are transmembrane receptors for semaphorins, a large family of proteins that regulate axon guidance, cell motility and migration, and the immune response. The encoded protein and its ligand regulate melanocyte adhesion, and viral semaphorins may modulate the immune response by binding to this receptor. The encoded protein may be a tumor suppressor protein for melanoma. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuron morphology and migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,065,314 R838I possibly damaging Het
Abca13 A G 11: 9,682,056 H4992R probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Akr1c20 T C 13: 4,510,223 E152G probably damaging Het
Ano4 T A 10: 88,952,327 D877V probably damaging Het
Asb18 A C 1: 90,014,538 S14A probably damaging Het
Atrnl1 T A 19: 57,630,292 Y147* probably null Het
Cbfa2t2 A G 2: 154,500,455 I30M possibly damaging Het
Cpd A T 11: 76,784,416 L1293* probably null Het
Csmd2 T C 4: 128,519,199 probably null Het
Cst9 G A 2: 148,838,473 V120I possibly damaging Het
Ddah2 A G 17: 35,060,688 D128G probably damaging Het
Defb11 T C 8: 21,905,494 I56V probably benign Het
Dnah17 A T 11: 118,034,367 L3880Q probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dopey1 A G 9: 86,507,570 T508A possibly damaging Het
Ephb2 T A 4: 136,660,737 H685L probably damaging Het
Glrb T C 3: 80,845,142 Y387C probably damaging Het
Gucy2e A G 11: 69,236,033 S205P possibly damaging Het
Has2 T A 15: 56,668,102 I406F probably damaging Het
Hcrtr2 A C 9: 76,323,287 V73G probably benign Het
Hsd17b4 A T 18: 50,183,172 Q622L probably benign Het
Nlrp1b A T 11: 71,181,196 M607K probably benign Het
Nol6 T A 4: 41,122,158 D184V probably benign Het
Noxa1 T A 2: 25,086,241 Q345L probably damaging Het
Nudt6 T C 3: 37,419,468 T35A probably benign Het
Plcg2 T C 8: 117,610,844 V985A probably benign Het
Prkdc G A 16: 15,734,098 R2056H probably benign Het
Ptpn4 A T 1: 119,684,516 I49N probably benign Het
Ralgapa1 T G 12: 55,677,113 S1543R probably damaging Het
Rnf135 A T 11: 80,199,086 N416I probably damaging Het
Scn5a A G 9: 119,521,333 L825P probably damaging Het
Sept11 A T 5: 93,139,450 N8I possibly damaging Het
Slc13a3 T C 2: 165,408,956 I456V probably benign Het
Slc16a3 A G 11: 120,956,930 T315A probably benign Het
Sun1 T G 5: 139,245,416 F657C probably damaging Het
Tmco3 T C 8: 13,310,314 S34P probably damaging Het
Tnrc18 G A 5: 142,773,747 P778L unknown Het
Ubxn4 A C 1: 128,266,321 K284T possibly damaging Het
Usp37 A T 1: 74,470,626 N461K probably damaging Het
Vmn2r106 A T 17: 20,278,871 F259L probably benign Het
Vmn2r73 T C 7: 85,875,748 D64G possibly damaging Het
Other mutations in Plxnc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Plxnc1 APN 10 94847549 missense probably benign 0.25
IGL01285:Plxnc1 APN 10 94799368 missense probably damaging 0.99
IGL01867:Plxnc1 APN 10 94798146 missense possibly damaging 0.61
IGL01994:Plxnc1 APN 10 94849939 missense probably damaging 1.00
IGL02083:Plxnc1 APN 10 94922725 missense possibly damaging 0.61
IGL02250:Plxnc1 APN 10 94871031 missense probably benign 0.00
IGL02429:Plxnc1 APN 10 94882591 missense probably benign 0.00
IGL02752:Plxnc1 APN 10 94794680 unclassified probably null
IGL02973:Plxnc1 APN 10 94810684 missense probably damaging 1.00
R0230:Plxnc1 UTSW 10 94799347 missense probably benign 0.07
R0265:Plxnc1 UTSW 10 94813129 missense probably benign 0.14
R0271:Plxnc1 UTSW 10 94837918 missense probably null 1.00
R0299:Plxnc1 UTSW 10 94849821 critical splice donor site probably null
R0361:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
R0441:Plxnc1 UTSW 10 94796482 missense probably damaging 1.00
R0558:Plxnc1 UTSW 10 94837935 missense probably damaging 1.00
R0617:Plxnc1 UTSW 10 94799368 missense probably damaging 1.00
R0671:Plxnc1 UTSW 10 94799332 missense possibly damaging 0.63
R0692:Plxnc1 UTSW 10 94837500 critical splice donor site probably null
R0751:Plxnc1 UTSW 10 94831333 splice site probably benign
R1184:Plxnc1 UTSW 10 94831333 splice site probably benign
R1260:Plxnc1 UTSW 10 94831365 missense probably damaging 0.99
R1680:Plxnc1 UTSW 10 94841551 missense probably benign 0.14
R1746:Plxnc1 UTSW 10 94844179 splice site probably null
R1750:Plxnc1 UTSW 10 94799497 missense probably damaging 1.00
R1751:Plxnc1 UTSW 10 94849815 unclassified probably benign
R1768:Plxnc1 UTSW 10 94844322 missense probably benign 0.05
R1876:Plxnc1 UTSW 10 94866941 missense possibly damaging 0.94
R2004:Plxnc1 UTSW 10 94852622 missense probably damaging 0.98
R2031:Plxnc1 UTSW 10 94943667 missense probably benign 0.26
R2184:Plxnc1 UTSW 10 94944269 missense probably damaging 1.00
R2437:Plxnc1 UTSW 10 94906533 missense probably benign 0.02
R2927:Plxnc1 UTSW 10 94793292 critical splice acceptor site probably null
R3001:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3002:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3003:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3441:Plxnc1 UTSW 10 94871010 missense probably benign 0.00
R3849:Plxnc1 UTSW 10 94794432 missense probably benign 0.01
R3884:Plxnc1 UTSW 10 94910687 intron probably null
R4004:Plxnc1 UTSW 10 94794597 nonsense probably null
R4679:Plxnc1 UTSW 10 94794444 missense probably damaging 1.00
R4730:Plxnc1 UTSW 10 94867468 intron probably benign
R4937:Plxnc1 UTSW 10 94841473 missense probably damaging 1.00
R5068:Plxnc1 UTSW 10 94799377 missense possibly damaging 0.91
R5345:Plxnc1 UTSW 10 94849969 missense probably benign 0.26
R5397:Plxnc1 UTSW 10 94843752 missense probably benign 0.08
R5416:Plxnc1 UTSW 10 94837554 missense probably damaging 1.00
R5485:Plxnc1 UTSW 10 94922742 missense probably benign 0.00
R5543:Plxnc1 UTSW 10 94864774 missense probably benign
R6007:Plxnc1 UTSW 10 94793290 missense possibly damaging 0.88
R6018:Plxnc1 UTSW 10 94943848 missense probably benign 0.21
R6052:Plxnc1 UTSW 10 94943773 missense probably benign 0.13
R6291:Plxnc1 UTSW 10 94833642 splice site probably null
R6653:Plxnc1 UTSW 10 94943876 missense probably damaging 1.00
R6984:Plxnc1 UTSW 10 94831530 missense probably damaging 1.00
R7086:Plxnc1 UTSW 10 94831435 missense probably benign
R7401:Plxnc1 UTSW 10 94871005 missense probably benign
R7727:Plxnc1 UTSW 10 94944109 missense probably damaging 1.00
R7789:Plxnc1 UTSW 10 94794477 missense probably damaging 1.00
R7803:Plxnc1 UTSW 10 94943515 critical splice donor site probably null
R7809:Plxnc1 UTSW 10 94794440 missense probably damaging 1.00
R7882:Plxnc1 UTSW 10 94843836 missense probably benign
R7965:Plxnc1 UTSW 10 94843836 missense probably benign
RF003:Plxnc1 UTSW 10 94794444 missense probably damaging 1.00
RF045:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
RF046:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
RF047:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
X0024:Plxnc1 UTSW 10 94864715 critical splice donor site probably null
Z1176:Plxnc1 UTSW 10 94865029 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CATTCCTAGAACAGTGAGTGTACC -3'
(R):5'- AATGTGCAGCTGTGAAGAGC -3'

Sequencing Primer
(F):5'- TCGACAGCAGCTTGGTCAGATAC -3'
(R):5'- TGCAGCTGTGAAGAGCCCATAG -3'
Posted On2016-12-20