Mutagenetix > Incidental Mutation

Incidental Mutation 'R5826:Gucy2e'

450183

Institutional Source

Beutler Lab

Gene Symbol

Gucy2e

Ensembl Gene

ENSMUSG00000020890

Gene Name

guanylate cyclase 2e

Synonyms

GC1, GC-E, ROS-GC1

MMRRC Submission

043217-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.262) question?

Stock #

R5826 (G1)

Quality Score

175

Status

Not validated

Chromosome

Chromosomal Location

69218117-69237036 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 69236033 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 205 (S205P)

Ref Sequence

ENSEMBL: ENSMUSP00000104305 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021259] [ENSMUST00000108664] [ENSMUST00000108665]

AlphaFold

P52785

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021259
AA Change: S205P

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000021259
Gene: ENSMUSG00000020890
AA Change: S205P

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
low complexity region	36	55	N/A	INTRINSIC
Pfam:ANF_receptor	75	403	5.3e-37	PFAM
transmembrane domain	468	490	N/A	INTRINSIC
Pfam:Pkinase	557	807	1.1e-24	PFAM
Pfam:Pkinase_Tyr	560	807	2e-29	PFAM
CYCc	847	1050	7.78e-104	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108664
AA Change: S205P

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000104304
Gene: ENSMUSG00000020890
AA Change: S205P

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
low complexity region	36	55	N/A	INTRINSIC
Pfam:ANF_receptor	75	403	2.4e-40	PFAM
transmembrane domain	468	490	N/A	INTRINSIC
Pfam:Pkinase	560	807	9.5e-23	PFAM
Pfam:Pkinase_Tyr	560	807	7.7e-29	PFAM
CYCc	847	1050	7.78e-104	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108665
AA Change: S205P

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000104305
Gene: ENSMUSG00000020890
AA Change: S205P

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
low complexity region	36	55	N/A	INTRINSIC
Pfam:ANF_receptor	75	403	5.3e-37	PFAM
transmembrane domain	468	490	N/A	INTRINSIC
Pfam:Pkinase	557	807	1.1e-24	PFAM
Pfam:Pkinase_Tyr	560	807	2e-29	PFAM
CYCc	847	1050	7.78e-104	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155457

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158813

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retina-specific guanylate cyclase, which is a member of the membrane guanylyl cyclase family. Like other membrane guanylyl cyclases, this enzyme has a hydrophobic amino-terminal signal sequence followed by a large extracellular domain, a single membrane spanning domain, a kinase homology domain, and a guanylyl cyclase catalytic domain. In contrast to other membrane guanylyl cyclases, this enzyme is not activated by natriuretic peptides. Mutations in this gene result in Leber congenital amaurosis and cone-rod dystrophy-6 diseases. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal retinal cone cell morphology, impaired cone and rod electrophysiology, and severe retinal cone cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	C	A	17: 33,065,314	R838I	possibly damaging	Het
Abca13	A	G	11: 9,682,056	H4992R	probably damaging	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Akr1c20	T	C	13: 4,510,223	E152G	probably damaging	Het
Ano4	T	A	10: 88,952,327	D877V	probably damaging	Het
Asb18	A	C	1: 90,014,538	S14A	probably damaging	Het
Atrnl1	T	A	19: 57,630,292	Y147*	probably null	Het
Cbfa2t2	A	G	2: 154,500,455	I30M	possibly damaging	Het
Cpd	A	T	11: 76,784,416	L1293*	probably null	Het
Csmd2	T	C	4: 128,519,199		probably null	Het
Cst9	G	A	2: 148,838,473	V120I	possibly damaging	Het
Ddah2	A	G	17: 35,060,688	D128G	probably damaging	Het
Defb11	T	C	8: 21,905,494	I56V	probably benign	Het
Dnah17	A	T	11: 118,034,367	L3880Q	probably damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Dopey1	A	G	9: 86,507,570	T508A	possibly damaging	Het
Ephb2	T	A	4: 136,660,737	H685L	probably damaging	Het
Glrb	T	C	3: 80,845,142	Y387C	probably damaging	Het
Has2	T	A	15: 56,668,102	I406F	probably damaging	Het
Hcrtr2	A	C	9: 76,323,287	V73G	probably benign	Het
Hsd17b4	A	T	18: 50,183,172	Q622L	probably benign	Het
Nlrp1b	A	T	11: 71,181,196	M607K	probably benign	Het
Nol6	T	A	4: 41,122,158	D184V	probably benign	Het
Noxa1	T	A	2: 25,086,241	Q345L	probably damaging	Het
Nudt6	T	C	3: 37,419,468	T35A	probably benign	Het
Plcg2	T	C	8: 117,610,844	V985A	probably benign	Het
Plxnc1	C	T	10: 94,799,473		probably null	Het
Prkdc	G	A	16: 15,734,098	R2056H	probably benign	Het
Ptpn4	A	T	1: 119,684,516	I49N	probably benign	Het
Ralgapa1	T	G	12: 55,677,113	S1543R	probably damaging	Het
Rnf135	A	T	11: 80,199,086	N416I	probably damaging	Het
Scn5a	A	G	9: 119,521,333	L825P	probably damaging	Het
Sept11	A	T	5: 93,139,450	N8I	possibly damaging	Het
Slc13a3	T	C	2: 165,408,956	I456V	probably benign	Het
Slc16a3	A	G	11: 120,956,930	T315A	probably benign	Het
Sun1	T	G	5: 139,245,416	F657C	probably damaging	Het
Tmco3	T	C	8: 13,310,314	S34P	probably damaging	Het
Tnrc18	G	A	5: 142,773,747	P778L	unknown	Het
Ubxn4	A	C	1: 128,266,321	K284T	possibly damaging	Het
Usp37	A	T	1: 74,470,626	N461K	probably damaging	Het
Vmn2r106	A	T	17: 20,278,871	F259L	probably benign	Het
Vmn2r73	T	C	7: 85,875,748	D64G	possibly damaging	Het

Other mutations in Gucy2e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00916:Gucy2e	APN	11	69223097	missense	possibly damaging	0.88
IGL01626:Gucy2e	APN	11	69232855	missense	possibly damaging	0.80
IGL01756:Gucy2e	APN	11	69232852	missense	probably damaging	0.98
IGL02030:Gucy2e	APN	11	69223816	missense	probably damaging	1.00
IGL02095:Gucy2e	APN	11	69232787	missense	possibly damaging	0.48
IGL02387:Gucy2e	APN	11	69236116	missense	probably benign
IGL02622:Gucy2e	APN	11	69225031	missense	probably damaging	1.00
IGL02660:Gucy2e	APN	11	69232007	missense	probably benign	0.18
IGL03181:Gucy2e	APN	11	69230182	splice site	probably benign
R0110:Gucy2e	UTSW	11	69235576	missense	probably benign	0.00
R0115:Gucy2e	UTSW	11	69236632	missense	unknown
R0450:Gucy2e	UTSW	11	69235576	missense	probably benign	0.00
R0469:Gucy2e	UTSW	11	69235576	missense	probably benign	0.00
R0497:Gucy2e	UTSW	11	69224159	missense	probably damaging	1.00
R0510:Gucy2e	UTSW	11	69235576	missense	probably benign	0.00
R1252:Gucy2e	UTSW	11	69235659	missense	probably benign
R1535:Gucy2e	UTSW	11	69226244	missense	probably damaging	1.00
R1700:Gucy2e	UTSW	11	69232058	missense	probably benign
R2035:Gucy2e	UTSW	11	69227532	missense	probably benign	0.12
R2179:Gucy2e	UTSW	11	69228578	splice site	probably null
R3622:Gucy2e	UTSW	11	69225051	missense	probably damaging	1.00
R4212:Gucy2e	UTSW	11	69228123	missense	probably damaging	0.99
R4600:Gucy2e	UTSW	11	69236168	missense	possibly damaging	0.71
R4790:Gucy2e	UTSW	11	69228448	missense	probably damaging	1.00
R5170:Gucy2e	UTSW	11	69235570	missense	probably damaging	0.97
R5174:Gucy2e	UTSW	11	69236566	missense	probably benign
R5440:Gucy2e	UTSW	11	69223646	missense	probably damaging	0.98
R5586:Gucy2e	UTSW	11	69226256	missense	probably damaging	1.00
R5668:Gucy2e	UTSW	11	69228381	missense	probably damaging	1.00
R5820:Gucy2e	UTSW	11	69232696	missense	probably benign	0.36
R6169:Gucy2e	UTSW	11	69236104	missense	probably benign	0.19
R6544:Gucy2e	UTSW	11	69235657	missense	probably benign
R6815:Gucy2e	UTSW	11	69232001	missense	possibly damaging	0.86
R7020:Gucy2e	UTSW	11	69232793	missense	probably benign	0.00
R7592:Gucy2e	UTSW	11	69223324	critical splice donor site	probably null
R7658:Gucy2e	UTSW	11	69226229	nonsense	probably null
R7812:Gucy2e	UTSW	11	69226243	missense	probably damaging	1.00
R8284:Gucy2e	UTSW	11	69232351	missense	probably benign
R8479:Gucy2e	UTSW	11	69232963	missense	probably benign	0.22
R8537:Gucy2e	UTSW	11	69236353	missense	probably benign	0.01
R8806:Gucy2e	UTSW	11	69236116	missense	probably benign
R9030:Gucy2e	UTSW	11	69225001	missense	probably damaging	1.00
R9192:Gucy2e	UTSW	11	69236477	missense	probably damaging	1.00
R9217:Gucy2e	UTSW	11	69235952	missense	possibly damaging	0.63
R9304:Gucy2e	UTSW	11	69235734	missense	probably benign	0.20
R9566:Gucy2e	UTSW	11	69228121	missense	probably damaging	1.00
R9784:Gucy2e	UTSW	11	69232690	missense	probably benign
X0025:Gucy2e	UTSW	11	69226244	missense	probably damaging	1.00
Z1186:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1186:Gucy2e	UTSW	11	69236603	missense	unknown
Z1187:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1187:Gucy2e	UTSW	11	69236603	missense	unknown
Z1188:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1188:Gucy2e	UTSW	11	69236603	missense	unknown
Z1189:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1189:Gucy2e	UTSW	11	69236603	missense	unknown
Z1190:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1190:Gucy2e	UTSW	11	69236603	missense	unknown
Z1191:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1191:Gucy2e	UTSW	11	69236603	missense	unknown
Z1192:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1192:Gucy2e	UTSW	11	69236603	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCACCATGATCACTACTGCG -3'
(R):5'- CGAACTGTTGGCTCAAGAAG -3'

Sequencing Primer
(F):5'- ACAGAGGCTGGCTCGCTAC -3'
(R):5'- GCTGGAGTAGCGCTGGTG -3'

Posted On

2016-12-20