Incidental Mutation 'R5826:Gucy2e'
ID450183
Institutional Source Beutler Lab
Gene Symbol Gucy2e
Ensembl Gene ENSMUSG00000020890
Gene Nameguanylate cyclase 2e
SynonymsGC1, GC-E, ROS-GC1
MMRRC Submission 043217-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R5826 (G1)
Quality Score175
Status Not validated
Chromosome11
Chromosomal Location69218117-69237036 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69236033 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 205 (S205P)
Ref Sequence ENSEMBL: ENSMUSP00000104305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021259] [ENSMUST00000108664] [ENSMUST00000108665]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021259
AA Change: S205P

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021259
Gene: ENSMUSG00000020890
AA Change: S205P

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:ANF_receptor 75 403 5.3e-37 PFAM
transmembrane domain 468 490 N/A INTRINSIC
Pfam:Pkinase 557 807 1.1e-24 PFAM
Pfam:Pkinase_Tyr 560 807 2e-29 PFAM
CYCc 847 1050 7.78e-104 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108664
AA Change: S205P

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104304
Gene: ENSMUSG00000020890
AA Change: S205P

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:ANF_receptor 75 403 2.4e-40 PFAM
transmembrane domain 468 490 N/A INTRINSIC
Pfam:Pkinase 560 807 9.5e-23 PFAM
Pfam:Pkinase_Tyr 560 807 7.7e-29 PFAM
CYCc 847 1050 7.78e-104 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108665
AA Change: S205P

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104305
Gene: ENSMUSG00000020890
AA Change: S205P

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:ANF_receptor 75 403 5.3e-37 PFAM
transmembrane domain 468 490 N/A INTRINSIC
Pfam:Pkinase 557 807 1.1e-24 PFAM
Pfam:Pkinase_Tyr 560 807 2e-29 PFAM
CYCc 847 1050 7.78e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158813
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retina-specific guanylate cyclase, which is a member of the membrane guanylyl cyclase family. Like other membrane guanylyl cyclases, this enzyme has a hydrophobic amino-terminal signal sequence followed by a large extracellular domain, a single membrane spanning domain, a kinase homology domain, and a guanylyl cyclase catalytic domain. In contrast to other membrane guanylyl cyclases, this enzyme is not activated by natriuretic peptides. Mutations in this gene result in Leber congenital amaurosis and cone-rod dystrophy-6 diseases. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal retinal cone cell morphology, impaired cone and rod electrophysiology, and severe retinal cone cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,065,314 R838I possibly damaging Het
Abca13 A G 11: 9,682,056 H4992R probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Akr1c20 T C 13: 4,510,223 E152G probably damaging Het
Ano4 T A 10: 88,952,327 D877V probably damaging Het
Asb18 A C 1: 90,014,538 S14A probably damaging Het
Atrnl1 T A 19: 57,630,292 Y147* probably null Het
Cbfa2t2 A G 2: 154,500,455 I30M possibly damaging Het
Cpd A T 11: 76,784,416 L1293* probably null Het
Csmd2 T C 4: 128,519,199 probably null Het
Cst9 G A 2: 148,838,473 V120I possibly damaging Het
Ddah2 A G 17: 35,060,688 D128G probably damaging Het
Defb11 T C 8: 21,905,494 I56V probably benign Het
Dnah17 A T 11: 118,034,367 L3880Q probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dopey1 A G 9: 86,507,570 T508A possibly damaging Het
Ephb2 T A 4: 136,660,737 H685L probably damaging Het
Glrb T C 3: 80,845,142 Y387C probably damaging Het
Has2 T A 15: 56,668,102 I406F probably damaging Het
Hcrtr2 A C 9: 76,323,287 V73G probably benign Het
Hsd17b4 A T 18: 50,183,172 Q622L probably benign Het
Nlrp1b A T 11: 71,181,196 M607K probably benign Het
Nol6 T A 4: 41,122,158 D184V probably benign Het
Noxa1 T A 2: 25,086,241 Q345L probably damaging Het
Nudt6 T C 3: 37,419,468 T35A probably benign Het
Plcg2 T C 8: 117,610,844 V985A probably benign Het
Plxnc1 C T 10: 94,799,473 probably null Het
Prkdc G A 16: 15,734,098 R2056H probably benign Het
Ptpn4 A T 1: 119,684,516 I49N probably benign Het
Ralgapa1 T G 12: 55,677,113 S1543R probably damaging Het
Rnf135 A T 11: 80,199,086 N416I probably damaging Het
Scn5a A G 9: 119,521,333 L825P probably damaging Het
Sept11 A T 5: 93,139,450 N8I possibly damaging Het
Slc13a3 T C 2: 165,408,956 I456V probably benign Het
Slc16a3 A G 11: 120,956,930 T315A probably benign Het
Sun1 T G 5: 139,245,416 F657C probably damaging Het
Tmco3 T C 8: 13,310,314 S34P probably damaging Het
Tnrc18 G A 5: 142,773,747 P778L unknown Het
Ubxn4 A C 1: 128,266,321 K284T possibly damaging Het
Usp37 A T 1: 74,470,626 N461K probably damaging Het
Vmn2r106 A T 17: 20,278,871 F259L probably benign Het
Vmn2r73 T C 7: 85,875,748 D64G possibly damaging Het
Other mutations in Gucy2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Gucy2e APN 11 69223097 missense possibly damaging 0.88
IGL01626:Gucy2e APN 11 69232855 missense possibly damaging 0.80
IGL01756:Gucy2e APN 11 69232852 missense probably damaging 0.98
IGL02030:Gucy2e APN 11 69223816 missense probably damaging 1.00
IGL02095:Gucy2e APN 11 69232787 missense possibly damaging 0.48
IGL02387:Gucy2e APN 11 69236116 missense probably benign
IGL02622:Gucy2e APN 11 69225031 missense probably damaging 1.00
IGL02660:Gucy2e APN 11 69232007 missense probably benign 0.18
IGL03181:Gucy2e APN 11 69230182 splice site probably benign
R0110:Gucy2e UTSW 11 69235576 missense probably benign 0.00
R0115:Gucy2e UTSW 11 69236632 missense unknown
R0450:Gucy2e UTSW 11 69235576 missense probably benign 0.00
R0469:Gucy2e UTSW 11 69235576 missense probably benign 0.00
R0497:Gucy2e UTSW 11 69224159 missense probably damaging 1.00
R0510:Gucy2e UTSW 11 69235576 missense probably benign 0.00
R1252:Gucy2e UTSW 11 69235659 missense probably benign
R1535:Gucy2e UTSW 11 69226244 missense probably damaging 1.00
R1700:Gucy2e UTSW 11 69232058 missense probably benign
R2035:Gucy2e UTSW 11 69227532 missense probably benign 0.12
R2179:Gucy2e UTSW 11 69228578 splice site probably null
R3622:Gucy2e UTSW 11 69225051 missense probably damaging 1.00
R4212:Gucy2e UTSW 11 69228123 missense probably damaging 0.99
R4600:Gucy2e UTSW 11 69236168 missense possibly damaging 0.71
R4790:Gucy2e UTSW 11 69228448 missense probably damaging 1.00
R5170:Gucy2e UTSW 11 69235570 missense probably damaging 0.97
R5174:Gucy2e UTSW 11 69236566 missense probably benign
R5440:Gucy2e UTSW 11 69223646 missense probably damaging 0.98
R5586:Gucy2e UTSW 11 69226256 missense probably damaging 1.00
R5668:Gucy2e UTSW 11 69228381 missense probably damaging 1.00
R5820:Gucy2e UTSW 11 69232696 missense probably benign 0.36
R6169:Gucy2e UTSW 11 69236104 missense probably benign 0.19
R6544:Gucy2e UTSW 11 69235657 missense probably benign
R6815:Gucy2e UTSW 11 69232001 missense possibly damaging 0.86
R7020:Gucy2e UTSW 11 69232793 missense probably benign 0.00
R7592:Gucy2e UTSW 11 69223324 critical splice donor site probably null
R7658:Gucy2e UTSW 11 69226229 nonsense probably null
R7812:Gucy2e UTSW 11 69226243 missense probably damaging 1.00
R8284:Gucy2e UTSW 11 69232351 missense probably benign
R8479:Gucy2e UTSW 11 69232963 missense probably benign 0.22
R8537:Gucy2e UTSW 11 69236353 missense probably benign 0.01
R8806:Gucy2e UTSW 11 69236116 missense probably benign
X0025:Gucy2e UTSW 11 69226244 missense probably damaging 1.00
Z1186:Gucy2e UTSW 11 69223605 missense probably benign 0.00
Z1186:Gucy2e UTSW 11 69236603 missense unknown
Z1187:Gucy2e UTSW 11 69223605 missense probably benign 0.00
Z1187:Gucy2e UTSW 11 69236603 missense unknown
Z1188:Gucy2e UTSW 11 69223605 missense probably benign 0.00
Z1188:Gucy2e UTSW 11 69236603 missense unknown
Z1189:Gucy2e UTSW 11 69223605 missense probably benign 0.00
Z1189:Gucy2e UTSW 11 69236603 missense unknown
Z1190:Gucy2e UTSW 11 69223605 missense probably benign 0.00
Z1190:Gucy2e UTSW 11 69236603 missense unknown
Z1191:Gucy2e UTSW 11 69223605 missense probably benign 0.00
Z1191:Gucy2e UTSW 11 69236603 missense unknown
Z1192:Gucy2e UTSW 11 69223605 missense probably benign 0.00
Z1192:Gucy2e UTSW 11 69236603 missense unknown
Predicted Primers PCR Primer
(F):5'- TCACCATGATCACTACTGCG -3'
(R):5'- CGAACTGTTGGCTCAAGAAG -3'

Sequencing Primer
(F):5'- ACAGAGGCTGGCTCGCTAC -3'
(R):5'- GCTGGAGTAGCGCTGGTG -3'
Posted On2016-12-20