Incidental Mutation 'R5826:Slc16a3'
ID450189
Institutional Source Beutler Lab
Gene Symbol Slc16a3
Ensembl Gene ENSMUSG00000025161
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 3
SynonymsMCT4, monocarboxylate transporter 4, MCT3
MMRRC Submission 043217-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5826 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120948480-120960868 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120956930 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 315 (T315A)
Ref Sequence ENSEMBL: ENSMUSP00000125846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018274] [ENSMUST00000070575] [ENSMUST00000070653] [ENSMUST00000100130] [ENSMUST00000129473] [ENSMUST00000133029] [ENSMUST00000154187] [ENSMUST00000168579]
Predicted Effect probably benign
Transcript: ENSMUST00000018274
SMART Domains Protein: ENSMUSP00000018274
Gene: ENSMUSG00000025162

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 3.7e-18 PFAM
Pfam:Pkinase 9 277 1.8e-28 PFAM
low complexity region 299 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070575
SMART Domains Protein: ENSMUSP00000070721
Gene: ENSMUSG00000025162

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 1.6e-18 PFAM
Pfam:Pkinase 9 280 2.8e-41 PFAM
low complexity region 299 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070653
AA Change: T315A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068854
Gene: ENSMUSG00000025161
AA Change: T315A

DomainStartEndE-ValueType
Pfam:MFS_1 25 375 6.3e-32 PFAM
transmembrane domain 390 412 N/A INTRINSIC
low complexity region 420 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100130
AA Change: T315A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097706
Gene: ENSMUSG00000025161
AA Change: T315A

DomainStartEndE-ValueType
Pfam:MFS_1 25 375 6.3e-32 PFAM
transmembrane domain 390 412 N/A INTRINSIC
low complexity region 420 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129473
SMART Domains Protein: ENSMUSP00000117275
Gene: ENSMUSG00000025161

DomainStartEndE-ValueType
Pfam:MFS_1 25 290 5.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140467
Predicted Effect probably benign
Transcript: ENSMUST00000154187
SMART Domains Protein: ENSMUSP00000122784
Gene: ENSMUSG00000025161

DomainStartEndE-ValueType
Pfam:MFS_1 25 253 3.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168579
AA Change: T315A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125846
Gene: ENSMUSG00000025161
AA Change: T315A

DomainStartEndE-ValueType
Pfam:MFS_1 25 375 8.3e-32 PFAM
transmembrane domain 390 412 N/A INTRINSIC
low complexity region 420 432 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lactic acid and pyruvate transport across plasma membranes is catalyzed by members of the proton-linked monocarboxylate transporter (MCT) family, which has been designated solute carrier family-16. Each MCT appears to have slightly different substrate and inhibitor specificities and transport kinetics, which are related to the metabolic requirements of the tissues in which it is found. The MCTs, which include MCT1 (SLC16A1; MIM 600682) and MCT2 (SLC16A7; MIM 603654), are characterized by 12 predicted transmembrane domains (Price et al., 1998 [PubMed 9425115]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,065,314 R838I possibly damaging Het
Abca13 A G 11: 9,682,056 H4992R probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Akr1c20 T C 13: 4,510,223 E152G probably damaging Het
Ano4 T A 10: 88,952,327 D877V probably damaging Het
Asb18 A C 1: 90,014,538 S14A probably damaging Het
Atrnl1 T A 19: 57,630,292 Y147* probably null Het
Cbfa2t2 A G 2: 154,500,455 I30M possibly damaging Het
Cpd A T 11: 76,784,416 L1293* probably null Het
Csmd2 T C 4: 128,519,199 probably null Het
Cst9 G A 2: 148,838,473 V120I possibly damaging Het
Ddah2 A G 17: 35,060,688 D128G probably damaging Het
Defb11 T C 8: 21,905,494 I56V probably benign Het
Dnah17 A T 11: 118,034,367 L3880Q probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dopey1 A G 9: 86,507,570 T508A possibly damaging Het
Ephb2 T A 4: 136,660,737 H685L probably damaging Het
Glrb T C 3: 80,845,142 Y387C probably damaging Het
Gucy2e A G 11: 69,236,033 S205P possibly damaging Het
Has2 T A 15: 56,668,102 I406F probably damaging Het
Hcrtr2 A C 9: 76,323,287 V73G probably benign Het
Hsd17b4 A T 18: 50,183,172 Q622L probably benign Het
Nlrp1b A T 11: 71,181,196 M607K probably benign Het
Nol6 T A 4: 41,122,158 D184V probably benign Het
Noxa1 T A 2: 25,086,241 Q345L probably damaging Het
Nudt6 T C 3: 37,419,468 T35A probably benign Het
Plcg2 T C 8: 117,610,844 V985A probably benign Het
Plxnc1 C T 10: 94,799,473 probably null Het
Prkdc G A 16: 15,734,098 R2056H probably benign Het
Ptpn4 A T 1: 119,684,516 I49N probably benign Het
Ralgapa1 T G 12: 55,677,113 S1543R probably damaging Het
Rnf135 A T 11: 80,199,086 N416I probably damaging Het
Scn5a A G 9: 119,521,333 L825P probably damaging Het
Sept11 A T 5: 93,139,450 N8I possibly damaging Het
Slc13a3 T C 2: 165,408,956 I456V probably benign Het
Sun1 T G 5: 139,245,416 F657C probably damaging Het
Tmco3 T C 8: 13,310,314 S34P probably damaging Het
Tnrc18 G A 5: 142,773,747 P778L unknown Het
Ubxn4 A C 1: 128,266,321 K284T possibly damaging Het
Usp37 A T 1: 74,470,626 N461K probably damaging Het
Vmn2r106 A T 17: 20,278,871 F259L probably benign Het
Vmn2r73 T C 7: 85,875,748 D64G possibly damaging Het
Other mutations in Slc16a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01662:Slc16a3 APN 11 120956706 nonsense probably null
IGL01943:Slc16a3 APN 11 120956883 unclassified probably null
IGL01967:Slc16a3 APN 11 120957038 missense probably damaging 0.99
IGL01970:Slc16a3 APN 11 120957038 missense probably damaging 0.99
IGL02189:Slc16a3 APN 11 120956771 missense probably benign 0.01
PIT4131001:Slc16a3 UTSW 11 120955346 missense probably damaging 1.00
R0010:Slc16a3 UTSW 11 120956705 missense probably benign 0.00
R0466:Slc16a3 UTSW 11 120958052 missense possibly damaging 0.77
R3967:Slc16a3 UTSW 11 120955425 missense possibly damaging 0.63
R4471:Slc16a3 UTSW 11 120955948 splice site probably benign
R4913:Slc16a3 UTSW 11 120957968 missense probably benign
R5863:Slc16a3 UTSW 11 120957953 missense probably benign
R6019:Slc16a3 UTSW 11 120957105 unclassified probably null
R7503:Slc16a3 UTSW 11 120957027 missense probably damaging 1.00
X0022:Slc16a3 UTSW 11 120956702 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCTATGCTAAGGATATGGGTGTAC -3'
(R):5'- TAGCTGTTGACACCTGCTGG -3'

Sequencing Primer
(F):5'- TGTACCCGACACAAAGGCCG -3'
(R):5'- AGTCTCCTAACGCCGGGTATG -3'
Posted On2016-12-20