Incidental Mutation 'R5826:Atrnl1'
ID450200
Institutional Source Beutler Lab
Gene Symbol Atrnl1
Ensembl Gene ENSMUSG00000054843
Gene Nameattractin like 1
SynonymsAlp
MMRRC Submission 043217-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R5826 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location57611034-58133338 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 57630292 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 147 (Y147*)
Ref Sequence ENSEMBL: ENSMUSP00000076514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077282]
Predicted Effect probably null
Transcript: ENSMUST00000077282
AA Change: Y147*
SMART Domains Protein: ENSMUSP00000076514
Gene: ENSMUSG00000054843
AA Change: Y147*

DomainStartEndE-ValueType
low complexity region 25 32 N/A INTRINSIC
EGF 61 90 5.71e-1 SMART
CUB 92 208 1.43e-11 SMART
EGF 209 244 1.95e1 SMART
Pfam:EGF_2 248 279 5.8e-7 PFAM
Pfam:Kelch_5 350 391 2.1e-9 PFAM
Pfam:Kelch_6 354 401 5.8e-8 PFAM
Pfam:Kelch_4 465 517 4.3e-7 PFAM
Pfam:Kelch_1 519 573 2.7e-6 PFAM
PSI 613 656 3.38e-1 SMART
PSI 665 708 2e-3 SMART
PSI 714 759 1.72e-2 SMART
CLECT 747 872 2.86e-20 SMART
PSI 888 938 6.26e-5 SMART
PSI 941 1011 1.73e-7 SMART
EGF_Lam 1013 1056 1.07e-5 SMART
low complexity region 1157 1173 N/A INTRINSIC
transmembrane domain 1229 1251 N/A INTRINSIC
low complexity region 1261 1272 N/A INTRINSIC
low complexity region 1326 1339 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit normal coat coloring and normal brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,065,314 R838I possibly damaging Het
Abca13 A G 11: 9,682,056 H4992R probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Akr1c20 T C 13: 4,510,223 E152G probably damaging Het
Ano4 T A 10: 88,952,327 D877V probably damaging Het
Asb18 A C 1: 90,014,538 S14A probably damaging Het
Cbfa2t2 A G 2: 154,500,455 I30M possibly damaging Het
Cpd A T 11: 76,784,416 L1293* probably null Het
Csmd2 T C 4: 128,519,199 probably null Het
Cst9 G A 2: 148,838,473 V120I possibly damaging Het
Ddah2 A G 17: 35,060,688 D128G probably damaging Het
Defb11 T C 8: 21,905,494 I56V probably benign Het
Dnah17 A T 11: 118,034,367 L3880Q probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dopey1 A G 9: 86,507,570 T508A possibly damaging Het
Ephb2 T A 4: 136,660,737 H685L probably damaging Het
Glrb T C 3: 80,845,142 Y387C probably damaging Het
Gucy2e A G 11: 69,236,033 S205P possibly damaging Het
Has2 T A 15: 56,668,102 I406F probably damaging Het
Hcrtr2 A C 9: 76,323,287 V73G probably benign Het
Hsd17b4 A T 18: 50,183,172 Q622L probably benign Het
Nlrp1b A T 11: 71,181,196 M607K probably benign Het
Nol6 T A 4: 41,122,158 D184V probably benign Het
Noxa1 T A 2: 25,086,241 Q345L probably damaging Het
Nudt6 T C 3: 37,419,468 T35A probably benign Het
Plcg2 T C 8: 117,610,844 V985A probably benign Het
Plxnc1 C T 10: 94,799,473 probably null Het
Prkdc G A 16: 15,734,098 R2056H probably benign Het
Ptpn4 A T 1: 119,684,516 I49N probably benign Het
Ralgapa1 T G 12: 55,677,113 S1543R probably damaging Het
Rnf135 A T 11: 80,199,086 N416I probably damaging Het
Scn5a A G 9: 119,521,333 L825P probably damaging Het
Sept11 A T 5: 93,139,450 N8I possibly damaging Het
Slc13a3 T C 2: 165,408,956 I456V probably benign Het
Slc16a3 A G 11: 120,956,930 T315A probably benign Het
Sun1 T G 5: 139,245,416 F657C probably damaging Het
Tmco3 T C 8: 13,310,314 S34P probably damaging Het
Tnrc18 G A 5: 142,773,747 P778L unknown Het
Ubxn4 A C 1: 128,266,321 K284T possibly damaging Het
Usp37 A T 1: 74,470,626 N461K probably damaging Het
Vmn2r106 A T 17: 20,278,871 F259L probably benign Het
Vmn2r73 T C 7: 85,875,748 D64G possibly damaging Het
Other mutations in Atrnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Atrnl1 APN 19 57691817 missense probably benign 0.02
IGL00707:Atrnl1 APN 19 57673265 missense probably damaging 0.96
IGL00921:Atrnl1 APN 19 57702153 missense probably damaging 1.00
IGL01410:Atrnl1 APN 19 58131104 missense probably damaging 1.00
IGL01468:Atrnl1 APN 19 57699712 missense probably benign 0.02
IGL01756:Atrnl1 APN 19 57652948 missense probably benign
IGL01971:Atrnl1 APN 19 57753283 missense probably damaging 1.00
IGL02019:Atrnl1 APN 19 57691763 splice site probably benign
IGL02580:Atrnl1 APN 19 57714576 splice site probably benign
IGL02649:Atrnl1 APN 19 57650441 splice site probably benign
IGL02676:Atrnl1 APN 19 57691884 missense probably damaging 1.00
IGL03276:Atrnl1 APN 19 57652927 missense probably damaging 0.99
IGL03379:Atrnl1 APN 19 57642541 missense probably benign 0.02
Magnetogorsk UTSW 19 57630306 missense probably damaging 1.00
polar UTSW 19 57652950 missense probably benign 0.00
PIT4812001:Atrnl1 UTSW 19 57731623 missense probably benign 0.08
R0109:Atrnl1 UTSW 19 57755517 missense possibly damaging 0.78
R0308:Atrnl1 UTSW 19 57753288 missense probably benign 0.04
R0394:Atrnl1 UTSW 19 57673176 missense probably benign 0.10
R0734:Atrnl1 UTSW 19 57654861 missense probably damaging 1.00
R0811:Atrnl1 UTSW 19 57673141 missense probably benign 0.07
R0812:Atrnl1 UTSW 19 57673141 missense probably benign 0.07
R1183:Atrnl1 UTSW 19 57650293 missense probably damaging 0.97
R1213:Atrnl1 UTSW 19 57638462 missense probably benign 0.25
R1344:Atrnl1 UTSW 19 57935705 critical splice donor site probably null
R1418:Atrnl1 UTSW 19 57935705 critical splice donor site probably null
R1707:Atrnl1 UTSW 19 57686737 missense probably benign 0.00
R1748:Atrnl1 UTSW 19 57714702 missense probably damaging 0.99
R2051:Atrnl1 UTSW 19 57691849 missense probably benign 0.01
R2113:Atrnl1 UTSW 19 57755616 nonsense probably null
R2130:Atrnl1 UTSW 19 57654994 missense probably damaging 1.00
R3710:Atrnl1 UTSW 19 57657114 missense probably damaging 1.00
R3916:Atrnl1 UTSW 19 57935652 missense possibly damaging 0.82
R4524:Atrnl1 UTSW 19 57630306 missense probably damaging 1.00
R4707:Atrnl1 UTSW 19 57629158 missense probably damaging 0.97
R4712:Atrnl1 UTSW 19 57652950 missense probably benign 0.00
R4784:Atrnl1 UTSW 19 57629158 missense probably damaging 0.97
R4785:Atrnl1 UTSW 19 57629158 missense probably damaging 0.97
R4798:Atrnl1 UTSW 19 58042361 missense probably benign
R5172:Atrnl1 UTSW 19 57685513 nonsense probably null
R5226:Atrnl1 UTSW 19 57650335 missense probably benign
R5289:Atrnl1 UTSW 19 57657082 missense probably damaging 1.00
R5372:Atrnl1 UTSW 19 57755536 missense probably benign
R5737:Atrnl1 UTSW 19 57777888 missense possibly damaging 0.84
R5782:Atrnl1 UTSW 19 57753286 missense possibly damaging 0.95
R6169:Atrnl1 UTSW 19 57642463 missense probably benign 0.00
R6242:Atrnl1 UTSW 19 57642478 missense probably benign 0.02
R6342:Atrnl1 UTSW 19 57638510 missense probably damaging 1.00
R6372:Atrnl1 UTSW 19 57650332 missense probably benign 0.01
R6811:Atrnl1 UTSW 19 57654961 missense probably damaging 0.98
R6897:Atrnl1 UTSW 19 58042368 missense probably benign 0.01
R7024:Atrnl1 UTSW 19 57638450 critical splice acceptor site probably null
R7085:Atrnl1 UTSW 19 57691857 missense probably damaging 1.00
R7144:Atrnl1 UTSW 19 58042352 missense probably damaging 1.00
R7259:Atrnl1 UTSW 19 57935606 nonsense probably null
R7289:Atrnl1 UTSW 19 57650414 missense probably benign 0.13
R7310:Atrnl1 UTSW 19 57642424 missense possibly damaging 0.69
R7372:Atrnl1 UTSW 19 57935646 missense possibly damaging 0.47
R7432:Atrnl1 UTSW 19 57755524 missense probably damaging 1.00
R7478:Atrnl1 UTSW 19 57696312 missense possibly damaging 0.89
R7556:Atrnl1 UTSW 19 57654846 missense probably benign
R7567:Atrnl1 UTSW 19 57699523 missense probably damaging 0.98
R7608:Atrnl1 UTSW 19 57714687 missense probably damaging 1.00
R7632:Atrnl1 UTSW 19 57630306 missense probably damaging 1.00
R7655:Atrnl1 UTSW 19 57611379 nonsense probably null
R7656:Atrnl1 UTSW 19 57611379 nonsense probably null
R7718:Atrnl1 UTSW 19 57740183 nonsense probably null
R7721:Atrnl1 UTSW 19 57696331 missense probably benign 0.00
R7726:Atrnl1 UTSW 19 57702072 missense probably damaging 1.00
R7733:Atrnl1 UTSW 19 57701988 missense probably benign 0.00
R7774:Atrnl1 UTSW 19 57699671 missense probably damaging 1.00
R8010:Atrnl1 UTSW 19 57682446 missense probably benign 0.14
RF021:Atrnl1 UTSW 19 57642473 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGAGAGAACGTATTCATGCTAG -3'
(R):5'- CCGCGTTTACACTTAGGTTGAG -3'

Sequencing Primer
(F):5'- GACATCATATCAGTTTTTCCCTAGTG -3'
(R):5'- CACTTAGGTTGAGTCATAGTTCAC -3'
Posted On2016-12-20