Incidental Mutation 'R5827:Pcsk9'
ID450210
Institutional Source Beutler Lab
Gene Symbol Pcsk9
Ensembl Gene ENSMUSG00000044254
Gene Nameproprotein convertase subtilisin/kexin type 9
SynonymsNarc1
MMRRC Submission 043218-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5827 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location106442329-106464329 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106448947 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 368 (G368R)
Ref Sequence ENSEMBL: ENSMUSP00000055757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049507]
Predicted Effect probably damaging
Transcript: ENSMUST00000049507
AA Change: G368R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055757
Gene: ENSMUSG00000044254
AA Change: G368R

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:Peptidase_S8 180 438 3.1e-34 PFAM
low complexity region 471 481 N/A INTRINSIC
low complexity region 490 500 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an autocatalytic processing event with its prosegment in the ER and is constitutively secreted as an inactive protease into the extracellular matrix and trans-Golgi network. It is expressed in liver, intestine and kidney tissues and escorts specific receptors for lysosomal degradation. It plays a role in cholesterol and fatty acid metabolism. Mutations in this gene have been associated with autosomal dominant familial hypercholesterolemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice exhibit increased clearance of circulating cholesterol and decreased plasma cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Agl T C 3: 116,781,054 I34V probably damaging Het
Cavin4 A T 4: 48,672,074 D173V probably damaging Het
Chd9 A G 8: 90,989,450 D884G probably damaging Het
Col6a5 G A 9: 105,928,120 R1196* probably null Het
Disc1 T C 8: 125,135,365 L492P probably damaging Het
Dscam A G 16: 96,649,991 probably null Het
Fbxw4 T C 19: 45,579,657 T26A probably benign Het
Hist1h1t A G 13: 23,696,202 K113E possibly damaging Het
Klhl24 T A 16: 20,120,121 Y475* probably null Het
Map4k3 C T 17: 80,593,283 probably null Het
Mfsd6 T C 1: 52,662,392 E633G probably damaging Het
Mycn G A 12: 12,939,793 R201* probably null Het
Nek11 T C 9: 105,314,745 I155M probably damaging Het
Notch2 G A 3: 98,072,862 V231I possibly damaging Het
Npnt A C 3: 132,906,775 V187G possibly damaging Het
Nr1d2 C A 14: 18,222,248 V8L possibly damaging Het
Nup188 C T 2: 30,339,847 T1359I probably damaging Het
Olfr1029 C A 2: 85,975,306 P21Q probably benign Het
Olfr1277 A T 2: 111,269,921 W149R probably damaging Het
Olfr164 T A 16: 19,286,432 I104L probably benign Het
Olfr957 T A 9: 39,511,058 I221F probably damaging Het
P2rx2 C T 5: 110,340,329 R453Q probably benign Het
Pcdhb7 A G 18: 37,342,024 E71G probably benign Het
Pcdhb9 A T 18: 37,401,958 D335V possibly damaging Het
Ptgr2 G A 12: 84,295,336 probably null Het
Rhebl1 T A 15: 98,878,270 I168F probably damaging Het
Serpina3b A G 12: 104,130,777 T106A probably benign Het
Sh3pxd2b A G 11: 32,422,422 I530V probably benign Het
Skint10 T C 4: 112,746,775 T72A probably benign Het
Slx4 G T 16: 4,001,284 F8L possibly damaging Het
Tdp2 T C 13: 24,831,853 L41P probably damaging Het
Tiam2 A G 17: 3,448,489 I847V probably benign Het
Tmem200c A G 17: 68,842,009 E529G probably benign Het
Tnpo1 T C 13: 98,856,908 D590G probably damaging Het
Ube2cbp T C 9: 86,372,436 T331A possibly damaging Het
Ugt1a2 T A 1: 88,201,065 S143R probably damaging Het
Zfp58 A T 13: 67,491,293 C360S probably damaging Het
Other mutations in Pcsk9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Pcsk9 APN 4 106454646 missense probably benign 0.00
IGL02709:Pcsk9 APN 4 106447689 splice site probably benign
IGL02804:Pcsk9 APN 4 106456964 missense probably damaging 1.00
IGL02850:Pcsk9 APN 4 106458865 missense probably damaging 1.00
IGL03009:Pcsk9 APN 4 106454345 missense probably damaging 1.00
IGL03294:Pcsk9 APN 4 106446770 missense probably benign
R0271:Pcsk9 UTSW 4 106449049 splice site probably benign
R0321:Pcsk9 UTSW 4 106444694 missense probably benign
R0413:Pcsk9 UTSW 4 106454341 missense probably damaging 1.00
R0426:Pcsk9 UTSW 4 106450077 missense possibly damaging 0.77
R0783:Pcsk9 UTSW 4 106450117 missense probably benign 0.00
R2136:Pcsk9 UTSW 4 106446770 missense probably benign 0.00
R4056:Pcsk9 UTSW 4 106444702 missense probably benign 0.02
R4438:Pcsk9 UTSW 4 106458959 missense probably benign 0.00
R4683:Pcsk9 UTSW 4 106458895 missense possibly damaging 0.59
R4739:Pcsk9 UTSW 4 106447156 missense probably damaging 1.00
R4801:Pcsk9 UTSW 4 106447569 missense probably benign 0.43
R4802:Pcsk9 UTSW 4 106447569 missense probably benign 0.43
R5249:Pcsk9 UTSW 4 106463753 missense probably benign 0.01
R5307:Pcsk9 UTSW 4 106447174 missense probably damaging 1.00
R5320:Pcsk9 UTSW 4 106463791 missense probably benign 0.00
R5653:Pcsk9 UTSW 4 106458916 missense probably damaging 1.00
R6010:Pcsk9 UTSW 4 106454272 missense possibly damaging 0.92
R6019:Pcsk9 UTSW 4 106456876 missense probably benign 0.02
R6393:Pcsk9 UTSW 4 106447596 missense probably benign 0.00
R7472:Pcsk9 UTSW 4 106458897 missense probably benign 0.08
R7614:Pcsk9 UTSW 4 106447566 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- ATAAGCGCTGACCCAGAAG -3'
(R):5'- CACAGGTGATGGGATTTCAGGG -3'

Sequencing Primer
(F):5'- CCCAGAAGGTCAGGCACAG -3'
(R):5'- ATTTCAGGGGGCCACAGTG -3'
Posted On2016-12-20