Incidental Mutation 'R5827:Disc1'
ID450214
Institutional Source Beutler Lab
Gene Symbol Disc1
Ensembl Gene ENSMUSG00000043051
Gene Namedisrupted in schizophrenia 1
Synonyms
MMRRC Submission 043218-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R5827 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location125054195-125261858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125135365 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 492 (L492P)
Ref Sequence ENSEMBL: ENSMUSP00000112929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074562] [ENSMUST00000075730] [ENSMUST00000098311] [ENSMUST00000115885] [ENSMUST00000117658] [ENSMUST00000118942] [ENSMUST00000121953]
Predicted Effect probably damaging
Transcript: ENSMUST00000074562
AA Change: L494P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074147
Gene: ENSMUSG00000043051
AA Change: L494P

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075730
AA Change: L494P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075145
Gene: ENSMUSG00000043051
AA Change: L494P

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098311
AA Change: L494P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095914
Gene: ENSMUSG00000043051
AA Change: L494P

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115885
AA Change: L494P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111552
Gene: ENSMUSG00000043051
AA Change: L494P

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117658
AA Change: L494P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112757
Gene: ENSMUSG00000043051
AA Change: L494P

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118942
AA Change: L494P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112410
Gene: ENSMUSG00000043051
AA Change: L494P

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121953
AA Change: L492P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112929
Gene: ENSMUSG00000043051
AA Change: L492P

DomainStartEndE-ValueType
low complexity region 218 228 N/A INTRINSIC
low complexity region 286 322 N/A INTRINSIC
coiled coil region 370 395 N/A INTRINSIC
coiled coil region 447 494 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
low complexity region 622 634 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple coiled coil motifs which is located in the nucleus, cytoplasm and mitochondria. The protein is involved in neurite outgrowth and cortical development through its interaction with other proteins. This gene is disrupted in a t(1;11)(q42.1;q14.3) translocation which segregates with schizophrenia and related psychiatric disorders in a large Scottish family. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show altered anxiety, synaptic depression, LTP, impulsivity, social investigation, hyperactivity and prepulse inhibition. Homozygotes for a spontaneous allele show altered working memory. Different ENU mutations cause distinct depression and schizophrenia-like profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Agl T C 3: 116,781,054 I34V probably damaging Het
Cavin4 A T 4: 48,672,074 D173V probably damaging Het
Chd9 A G 8: 90,989,450 D884G probably damaging Het
Col6a5 G A 9: 105,928,120 R1196* probably null Het
Dscam A G 16: 96,649,991 probably null Het
Fbxw4 T C 19: 45,579,657 T26A probably benign Het
Hist1h1t A G 13: 23,696,202 K113E possibly damaging Het
Klhl24 T A 16: 20,120,121 Y475* probably null Het
Map4k3 C T 17: 80,593,283 probably null Het
Mfsd6 T C 1: 52,662,392 E633G probably damaging Het
Mycn G A 12: 12,939,793 R201* probably null Het
Nek11 T C 9: 105,314,745 I155M probably damaging Het
Notch2 G A 3: 98,072,862 V231I possibly damaging Het
Npnt A C 3: 132,906,775 V187G possibly damaging Het
Nr1d2 C A 14: 18,222,248 V8L possibly damaging Het
Nup188 C T 2: 30,339,847 T1359I probably damaging Het
Olfr1029 C A 2: 85,975,306 P21Q probably benign Het
Olfr1277 A T 2: 111,269,921 W149R probably damaging Het
Olfr164 T A 16: 19,286,432 I104L probably benign Het
Olfr957 T A 9: 39,511,058 I221F probably damaging Het
P2rx2 C T 5: 110,340,329 R453Q probably benign Het
Pcdhb7 A G 18: 37,342,024 E71G probably benign Het
Pcdhb9 A T 18: 37,401,958 D335V possibly damaging Het
Pcsk9 C T 4: 106,448,947 G368R probably damaging Het
Ptgr2 G A 12: 84,295,336 probably null Het
Rhebl1 T A 15: 98,878,270 I168F probably damaging Het
Serpina3b A G 12: 104,130,777 T106A probably benign Het
Sh3pxd2b A G 11: 32,422,422 I530V probably benign Het
Skint10 T C 4: 112,746,775 T72A probably benign Het
Slx4 G T 16: 4,001,284 F8L possibly damaging Het
Tdp2 T C 13: 24,831,853 L41P probably damaging Het
Tiam2 A G 17: 3,448,489 I847V probably benign Het
Tmem200c A G 17: 68,842,009 E529G probably benign Het
Tnpo1 T C 13: 98,856,908 D590G probably damaging Het
Ube2cbp T C 9: 86,372,436 T331A possibly damaging Het
Ugt1a2 T A 1: 88,201,065 S143R probably damaging Het
Zfp58 A T 13: 67,491,293 C360S probably damaging Het
Other mutations in Disc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Disc1 APN 8 125088275 missense probably benign 0.27
IGL01319:Disc1 APN 8 125087891 missense probably damaging 0.99
IGL02001:Disc1 APN 8 125251042 missense probably damaging 0.97
IGL02403:Disc1 APN 8 125135519 splice site probably benign
IGL02445:Disc1 APN 8 125148403 splice site probably benign
R0334:Disc1 UTSW 8 125261097 synonymous probably null
R0992:Disc1 UTSW 8 125088042 missense probably damaging 1.00
R1654:Disc1 UTSW 8 125148465 missense possibly damaging 0.90
R1711:Disc1 UTSW 8 125124610 missense probably benign 0.05
R3154:Disc1 UTSW 8 125135304 missense probably damaging 1.00
R3947:Disc1 UTSW 8 125088135 missense probably damaging 1.00
R3948:Disc1 UTSW 8 125088135 missense probably damaging 1.00
R3949:Disc1 UTSW 8 125088135 missense probably damaging 1.00
R4051:Disc1 UTSW 8 125148425 missense possibly damaging 0.85
R4199:Disc1 UTSW 8 125148459 missense probably damaging 1.00
R4691:Disc1 UTSW 8 125148447 missense possibly damaging 0.90
R4763:Disc1 UTSW 8 125124538 missense probably damaging 1.00
R4825:Disc1 UTSW 8 125135302 missense possibly damaging 0.86
R4969:Disc1 UTSW 8 125124550 nonsense probably null
R5087:Disc1 UTSW 8 125132160 missense probably benign
R5383:Disc1 UTSW 8 125135457 missense probably damaging 1.00
R5828:Disc1 UTSW 8 125251024 missense probably damaging 0.99
R6431:Disc1 UTSW 8 125135389 missense possibly damaging 0.87
R6501:Disc1 UTSW 8 125218105 missense probably benign 0.00
R6794:Disc1 UTSW 8 125087775 missense probably benign 0.37
R7058:Disc1 UTSW 8 125250985 missense probably damaging 1.00
R7350:Disc1 UTSW 8 125165102 missense probably damaging 1.00
R7365:Disc1 UTSW 8 125155041 missense probably damaging 1.00
R7732:Disc1 UTSW 8 125250975 nonsense probably null
R7757:Disc1 UTSW 8 125087504 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTTCTGGAATCTGCCTGCC -3'
(R):5'- GTTGGAAACTCAGAAAGTCACCAG -3'

Sequencing Primer
(F):5'- AATCTGCCTGCCTCGGAAG -3'
(R):5'- AGTCACCAGTACCTCCTGAG -3'
Posted On2016-12-20