Incidental Mutation 'R5827:Olfr957'
ID450215
Institutional Source Beutler Lab
Gene Symbol Olfr957
Ensembl Gene ENSMUSG00000095322
Gene Nameolfactory receptor 957
SynonymsGA_x6K02T2PVTD-33208209-33207274, MOR171-12
MMRRC Submission 043218-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R5827 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39510234-39515809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39511058 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 221 (I221F)
Ref Sequence ENSEMBL: ENSMUSP00000149559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051653] [ENSMUST00000216177]
Predicted Effect probably damaging
Transcript: ENSMUST00000051653
AA Change: I221F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054536
Gene: ENSMUSG00000095322
AA Change: I221F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-50 PFAM
Pfam:7tm_1 41 290 3.8e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216177
AA Change: I221F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Agl T C 3: 116,781,054 I34V probably damaging Het
Cavin4 A T 4: 48,672,074 D173V probably damaging Het
Chd9 A G 8: 90,989,450 D884G probably damaging Het
Col6a5 G A 9: 105,928,120 R1196* probably null Het
Disc1 T C 8: 125,135,365 L492P probably damaging Het
Dscam A G 16: 96,649,991 probably null Het
Fbxw4 T C 19: 45,579,657 T26A probably benign Het
Hist1h1t A G 13: 23,696,202 K113E possibly damaging Het
Klhl24 T A 16: 20,120,121 Y475* probably null Het
Map4k3 C T 17: 80,593,283 probably null Het
Mfsd6 T C 1: 52,662,392 E633G probably damaging Het
Mycn G A 12: 12,939,793 R201* probably null Het
Nek11 T C 9: 105,314,745 I155M probably damaging Het
Notch2 G A 3: 98,072,862 V231I possibly damaging Het
Npnt A C 3: 132,906,775 V187G possibly damaging Het
Nr1d2 C A 14: 18,222,248 V8L possibly damaging Het
Nup188 C T 2: 30,339,847 T1359I probably damaging Het
Olfr1029 C A 2: 85,975,306 P21Q probably benign Het
Olfr1277 A T 2: 111,269,921 W149R probably damaging Het
Olfr164 T A 16: 19,286,432 I104L probably benign Het
P2rx2 C T 5: 110,340,329 R453Q probably benign Het
Pcdhb7 A G 18: 37,342,024 E71G probably benign Het
Pcdhb9 A T 18: 37,401,958 D335V possibly damaging Het
Pcsk9 C T 4: 106,448,947 G368R probably damaging Het
Ptgr2 G A 12: 84,295,336 probably null Het
Rhebl1 T A 15: 98,878,270 I168F probably damaging Het
Serpina3b A G 12: 104,130,777 T106A probably benign Het
Sh3pxd2b A G 11: 32,422,422 I530V probably benign Het
Skint10 T C 4: 112,746,775 T72A probably benign Het
Slx4 G T 16: 4,001,284 F8L possibly damaging Het
Tdp2 T C 13: 24,831,853 L41P probably damaging Het
Tiam2 A G 17: 3,448,489 I847V probably benign Het
Tmem200c A G 17: 68,842,009 E529G probably benign Het
Tnpo1 T C 13: 98,856,908 D590G probably damaging Het
Ube2cbp T C 9: 86,372,436 T331A possibly damaging Het
Ugt1a2 T A 1: 88,201,065 S143R probably damaging Het
Zfp58 A T 13: 67,491,293 C360S probably damaging Het
Other mutations in Olfr957
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Olfr957 APN 9 39511046 missense possibly damaging 0.64
R0603:Olfr957 UTSW 9 39511514 missense possibly damaging 0.76
R1642:Olfr957 UTSW 9 39511354 missense possibly damaging 0.78
R2044:Olfr957 UTSW 9 39511378 missense probably damaging 0.99
R2182:Olfr957 UTSW 9 39511426 missense probably damaging 1.00
R2290:Olfr957 UTSW 9 39511678 missense possibly damaging 0.87
R4246:Olfr957 UTSW 9 39511603 missense probably benign 0.31
R4248:Olfr957 UTSW 9 39511603 missense probably benign 0.31
R5273:Olfr957 UTSW 9 39511499 missense possibly damaging 0.95
R5495:Olfr957 UTSW 9 39511145 missense probably benign 0.39
R5718:Olfr957 UTSW 9 39511042 missense probably damaging 1.00
R6261:Olfr957 UTSW 9 39510809 missense probably benign
R6917:Olfr957 UTSW 9 39511199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTATAGATCAAGGGGTTCAGC -3'
(R):5'- GGAAACAGTCTGCCTGCTTAG -3'

Sequencing Primer
(F):5'- GTTCAGCATGGGCACAAC -3'
(R):5'- GCTTAGACTGCTTTTCTGCAAAG -3'
Posted On2016-12-20