Incidental Mutation 'R0549:Lrrc28'
ID 45022
Institutional Source Beutler Lab
Gene Symbol Lrrc28
Ensembl Gene ENSMUSG00000030556
Gene Name leucine rich repeat containing 28
Synonyms 2210012C09Rik, 1300004K21Rik, 2310058O11Rik
MMRRC Submission 038741-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R0549 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 67513410-67645268 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 67628342 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032775] [ENSMUST00000053950] [ENSMUST00000187953] [ENSMUST00000189836] [ENSMUST00000190276] [ENSMUST00000191035]
AlphaFold Q3TX51
Predicted Effect probably benign
Transcript: ENSMUST00000032775
SMART Domains Protein: ENSMUSP00000032775
Gene: ENSMUSG00000030556

DomainStartEndE-ValueType
LRR 40 63 1.33e-1 SMART
LRR 64 86 3.24e0 SMART
LRR 87 109 1.06e1 SMART
LRR_TYP 110 132 7.78e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000053950
SMART Domains Protein: ENSMUSP00000052177
Gene: ENSMUSG00000030556

DomainStartEndE-ValueType
LRR 40 63 1.33e-1 SMART
LRR 64 86 3.24e0 SMART
LRR 87 109 1.06e1 SMART
LRR_TYP 110 132 6.67e-2 SMART
LRR 133 156 6.4e0 SMART
LRR 179 202 1.64e-1 SMART
low complexity region 304 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187953
Predicted Effect probably benign
Transcript: ENSMUST00000189836
SMART Domains Protein: ENSMUSP00000139606
Gene: ENSMUSG00000030556

DomainStartEndE-ValueType
Pfam:LRR_1 42 64 5.5e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190276
SMART Domains Protein: ENSMUSP00000140972
Gene: ENSMUSG00000030556

DomainStartEndE-ValueType
LRR 40 59 3.7e-3 SMART
LRR 64 83 1.2e0 SMART
LRR 87 109 4.4e-2 SMART
LRR_TYP 110 133 2.3e-6 SMART
LRR 133 153 1.1e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191035
SMART Domains Protein: ENSMUSP00000140382
Gene: ENSMUSG00000030556

DomainStartEndE-ValueType
LRR 40 63 1.33e-1 SMART
LRR 64 86 3.24e0 SMART
LRR 87 109 1.06e1 SMART
LRR 110 132 8.09e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,322,290 F498L probably damaging Het
Adamts6 A T 13: 104,297,255 D64V possibly damaging Het
Agbl2 T C 2: 90,789,843 probably benign Het
Angptl3 A G 4: 99,031,455 S151G probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
C4b G T 17: 34,735,415 L927I probably damaging Het
Ccl3 T C 11: 83,648,336 T66A probably damaging Het
Cdh7 T C 1: 110,108,944 L618P probably damaging Het
Cfap65 T C 1: 74,918,444 T989A probably benign Het
Cnpy4 T C 5: 138,187,637 F18S possibly damaging Het
Col6a5 A G 9: 105,904,579 probably benign Het
Dppa2 G A 16: 48,318,671 R289H probably benign Het
Evx2 T C 2: 74,659,134 T96A probably benign Het
Frmd4a A G 2: 4,603,967 E577G possibly damaging Het
Gcgr G A 11: 120,536,561 G166S probably benign Het
Gm4788 A T 1: 139,739,488 D377E probably damaging Het
Gm5316 T C 6: 122,900,191 noncoding transcript Het
Gria1 G A 11: 57,228,973 R292Q probably damaging Het
Hars2 T A 18: 36,786,208 probably null Het
Hkdc1 T A 10: 62,400,240 T508S probably benign Het
Kif2b A T 11: 91,576,584 I291N probably damaging Het
Lmbrd1 A T 1: 24,744,920 T377S probably benign Het
Mmp3 A T 9: 7,455,638 N463I probably benign Het
Myh6 A G 14: 54,958,608 F578S probably damaging Het
Ncbp1 T A 4: 46,168,476 M608K possibly damaging Het
Nf1 T C 11: 79,468,771 F1412L probably damaging Het
Nlrp5 T A 7: 23,441,802 W1083R probably damaging Het
Nrsn1 T C 13: 25,262,258 Y45C probably benign Het
Olfr401 T G 11: 74,121,475 M62R probably damaging Het
Osbpl7 G T 11: 97,067,542 R881L probably damaging Het
Papss1 A G 3: 131,619,213 E456G possibly damaging Het
Pbxip1 T A 3: 89,443,592 probably benign Het
Pcca A G 14: 122,638,377 probably benign Het
Pde1a T A 2: 79,865,070 N511I probably damaging Het
Prpf39 A T 12: 65,056,256 I435F probably benign Het
Rnf213 C T 11: 119,465,082 T4117M probably damaging Het
Sel1l2 A T 2: 140,265,882 M216K probably damaging Het
Sidt2 A G 9: 45,953,119 probably null Het
Sirt3 A T 7: 140,869,487 probably null Het
Smpd4 T C 16: 17,639,312 V378A probably benign Het
Svil T A 18: 5,064,566 S642T possibly damaging Het
Tcp10a A G 17: 7,326,551 K92E probably benign Het
Tmem144 T C 3: 79,822,744 D233G probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnik T C 3: 28,570,920 S335P possibly damaging Het
Ush2a T C 1: 188,946,953 L4786P probably damaging Het
Utp11 A T 4: 124,686,079 probably benign Het
Vmn1r67 A G 7: 10,447,714 N241D probably damaging Het
Vmn2r11 A T 5: 109,052,097 C497S possibly damaging Het
Other mutations in Lrrc28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Lrrc28 APN 7 67628294 critical splice donor site probably null
IGL01583:Lrrc28 APN 7 67545475 splice site probably null
IGL02033:Lrrc28 APN 7 67559857 critical splice donor site probably null
IGL02483:Lrrc28 APN 7 67617983 splice site probably benign
IGL02750:Lrrc28 APN 7 67531683 missense probably damaging 0.96
BB002:Lrrc28 UTSW 7 67619109 missense probably damaging 1.00
BB012:Lrrc28 UTSW 7 67619109 missense probably damaging 1.00
R0563:Lrrc28 UTSW 7 67545387 missense probably damaging 1.00
R0650:Lrrc28 UTSW 7 67618085 missense probably damaging 1.00
R0652:Lrrc28 UTSW 7 67618085 missense probably damaging 1.00
R1557:Lrrc28 UTSW 7 67559929 missense probably damaging 1.00
R1820:Lrrc28 UTSW 7 67641111 missense probably damaging 0.98
R2149:Lrrc28 UTSW 7 67531682 missense probably damaging 0.96
R2185:Lrrc28 UTSW 7 67545453 missense possibly damaging 0.70
R4479:Lrrc28 UTSW 7 67531614 critical splice donor site probably null
R5205:Lrrc28 UTSW 7 67531768 missense probably benign 0.00
R7008:Lrrc28 UTSW 7 67595711 intron probably benign
R7925:Lrrc28 UTSW 7 67619109 missense probably damaging 1.00
R8323:Lrrc28 UTSW 7 67595707 missense unknown
R8360:Lrrc28 UTSW 7 67641161 missense probably benign 0.01
R8898:Lrrc28 UTSW 7 67628294 critical splice donor site probably null
R8919:Lrrc28 UTSW 7 67619085 missense possibly damaging 0.88
R9412:Lrrc28 UTSW 7 67531764 missense probably damaging 1.00
Z1088:Lrrc28 UTSW 7 67529631 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGGTTAGCAAAGCCTCCCATCTAC -3'
(R):5'- TTCCTTACATGCCCTGAGAGGTGC -3'

Sequencing Primer
(F):5'- TCTACCCAGAGCAGCAGC -3'
(R):5'- gggggtggggtagggtg -3'
Posted On 2013-06-11