Incidental Mutation 'R5827:Mycn'
ID450222
Institutional Source Beutler Lab
Gene Symbol Mycn
Ensembl Gene ENSMUSG00000037169
Gene Namev-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived
SynonymsbHLHe37, Nmyc, Nmyc-1, N-myc, Nmyc1
MMRRC Submission 043218-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5827 (G1)
Quality Score105
Status Not validated
Chromosome12
Chromosomal Location12936093-12941914 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 12939793 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 201 (R201*)
Ref Sequence ENSEMBL: ENSMUSP00000114225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043396] [ENSMUST00000130990]
Predicted Effect probably null
Transcript: ENSMUST00000043396
AA Change: R201*
SMART Domains Protein: ENSMUSP00000045993
Gene: ENSMUSG00000037169
AA Change: R201*

DomainStartEndE-ValueType
Pfam:Myc_N 8 370 1.4e-120 PFAM
HLH 385 437 1.09e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000130990
AA Change: R201*
SMART Domains Protein: ENSMUSP00000114225
Gene: ENSMUSG00000037169
AA Change: R201*

DomainStartEndE-ValueType
Pfam:Myc_N 9 370 1.1e-148 PFAM
HLH 385 437 1.09e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151534
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MYC family and encodes a protein with a basic helix-loop-helix (bHLH) domain. This protein is located in the nucleus and must dimerize with another bHLH protein in order to bind DNA. Amplification of this gene is associated with a variety of tumors, most notably neuroblastomas. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired development of the mesonephric tubules, neuroepithelium, sensory ganglia, heart, lung, stomach, and liver. Mutants die around embryonic day 11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Agl T C 3: 116,781,054 I34V probably damaging Het
Cavin4 A T 4: 48,672,074 D173V probably damaging Het
Chd9 A G 8: 90,989,450 D884G probably damaging Het
Col6a5 G A 9: 105,928,120 R1196* probably null Het
Disc1 T C 8: 125,135,365 L492P probably damaging Het
Dscam A G 16: 96,649,991 probably null Het
Fbxw4 T C 19: 45,579,657 T26A probably benign Het
Hist1h1t A G 13: 23,696,202 K113E possibly damaging Het
Klhl24 T A 16: 20,120,121 Y475* probably null Het
Map4k3 C T 17: 80,593,283 probably null Het
Mfsd6 T C 1: 52,662,392 E633G probably damaging Het
Nek11 T C 9: 105,314,745 I155M probably damaging Het
Notch2 G A 3: 98,072,862 V231I possibly damaging Het
Npnt A C 3: 132,906,775 V187G possibly damaging Het
Nr1d2 C A 14: 18,222,248 V8L possibly damaging Het
Nup188 C T 2: 30,339,847 T1359I probably damaging Het
Olfr1029 C A 2: 85,975,306 P21Q probably benign Het
Olfr1277 A T 2: 111,269,921 W149R probably damaging Het
Olfr164 T A 16: 19,286,432 I104L probably benign Het
Olfr957 T A 9: 39,511,058 I221F probably damaging Het
P2rx2 C T 5: 110,340,329 R453Q probably benign Het
Pcdhb7 A G 18: 37,342,024 E71G probably benign Het
Pcdhb9 A T 18: 37,401,958 D335V possibly damaging Het
Pcsk9 C T 4: 106,448,947 G368R probably damaging Het
Ptgr2 G A 12: 84,295,336 probably null Het
Rhebl1 T A 15: 98,878,270 I168F probably damaging Het
Serpina3b A G 12: 104,130,777 T106A probably benign Het
Sh3pxd2b A G 11: 32,422,422 I530V probably benign Het
Skint10 T C 4: 112,746,775 T72A probably benign Het
Slx4 G T 16: 4,001,284 F8L possibly damaging Het
Tdp2 T C 13: 24,831,853 L41P probably damaging Het
Tiam2 A G 17: 3,448,489 I847V probably benign Het
Tmem200c A G 17: 68,842,009 E529G probably benign Het
Tnpo1 T C 13: 98,856,908 D590G probably damaging Het
Ube2cbp T C 9: 86,372,436 T331A possibly damaging Het
Ugt1a2 T A 1: 88,201,065 S143R probably damaging Het
Zfp58 A T 13: 67,491,293 C360S probably damaging Het
Other mutations in Mycn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Mycn APN 12 12937586 missense possibly damaging 0.91
IGL02012:Mycn APN 12 12937103 missense probably damaging 1.00
IGL02808:Mycn APN 12 12939892 missense probably benign
PIT4581001:Mycn UTSW 12 12940243 missense possibly damaging 0.82
R0282:Mycn UTSW 12 12937313 missense probably benign 0.02
R3910:Mycn UTSW 12 12937280 missense probably damaging 1.00
R4943:Mycn UTSW 12 12937079 missense probably damaging 1.00
R5667:Mycn UTSW 12 12940044 missense possibly damaging 0.73
R6594:Mycn UTSW 12 12940050 missense probably damaging 0.96
R7513:Mycn UTSW 12 12939742 missense probably benign 0.00
R7560:Mycn UTSW 12 12940291 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AGTCGCTCAAGGTATCCTCTCC -3'
(R):5'- CTTCAGGACTGCATGTGGAG -3'

Sequencing Primer
(F):5'- CGGAGGTGCTGAGGGCC -3'
(R):5'- TTCTCTGCCCGCGAGAAG -3'
Posted On2016-12-20