Incidental Mutation 'R5827:Tdp2'
ID450226
Institutional Source Beutler Lab
Gene Symbol Tdp2
Ensembl Gene ENSMUSG00000035958
Gene Nametyrosyl-DNA phosphodiesterase 2
SynonymsD13Ertd656e, Ttrap
MMRRC Submission 043218-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.672) question?
Stock #R5827 (G1)
Quality Score165
Status Not validated
Chromosome13
Chromosomal Location24831679-24842153 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24831853 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 41 (L41P)
Ref Sequence ENSEMBL: ENSMUSP00000153301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006900] [ENSMUST00000038039] [ENSMUST00000223804] [ENSMUST00000225138]
Predicted Effect probably benign
Transcript: ENSMUST00000006900
SMART Domains Protein: ENSMUSP00000006900
Gene: ENSMUSG00000006717

DomainStartEndE-ValueType
Pfam:4HBT 52 129 1.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000038039
AA Change: L41P

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035660
Gene: ENSMUSG00000035958
AA Change: L41P

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
Pfam:Exo_endo_phos 127 359 3.9e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130788
Predicted Effect probably damaging
Transcript: ENSMUST00000223804
AA Change: L41P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224542
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224839
Predicted Effect probably damaging
Transcript: ENSMUST00000225138
AA Change: L41P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226055
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a superfamily of divalent cation-dependent phosphodiesterases. The encoded protein associates with CD40, tumor necrosis factor (TNF) receptor-75 and TNF receptor associated factors (TRAFs), and inhibits nuclear factor-kappa-B activation. This protein has sequence and structural similarities with APE1 endonuclease, which is involved in both DNA repair and the activation of transcription factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice carrying a gene trap insertion into intron 5 but subsequently shown to harbor a partial duplication of the wild-type allele at the ES cell level are born with a normal Mendelian distribution. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Agl T C 3: 116,781,054 I34V probably damaging Het
Cavin4 A T 4: 48,672,074 D173V probably damaging Het
Chd9 A G 8: 90,989,450 D884G probably damaging Het
Col6a5 G A 9: 105,928,120 R1196* probably null Het
Disc1 T C 8: 125,135,365 L492P probably damaging Het
Dscam A G 16: 96,649,991 probably null Het
Fbxw4 T C 19: 45,579,657 T26A probably benign Het
Hist1h1t A G 13: 23,696,202 K113E possibly damaging Het
Klhl24 T A 16: 20,120,121 Y475* probably null Het
Map4k3 C T 17: 80,593,283 probably null Het
Mfsd6 T C 1: 52,662,392 E633G probably damaging Het
Mycn G A 12: 12,939,793 R201* probably null Het
Nek11 T C 9: 105,314,745 I155M probably damaging Het
Notch2 G A 3: 98,072,862 V231I possibly damaging Het
Npnt A C 3: 132,906,775 V187G possibly damaging Het
Nr1d2 C A 14: 18,222,248 V8L possibly damaging Het
Nup188 C T 2: 30,339,847 T1359I probably damaging Het
Olfr1029 C A 2: 85,975,306 P21Q probably benign Het
Olfr1277 A T 2: 111,269,921 W149R probably damaging Het
Olfr164 T A 16: 19,286,432 I104L probably benign Het
Olfr957 T A 9: 39,511,058 I221F probably damaging Het
P2rx2 C T 5: 110,340,329 R453Q probably benign Het
Pcdhb7 A G 18: 37,342,024 E71G probably benign Het
Pcdhb9 A T 18: 37,401,958 D335V possibly damaging Het
Pcsk9 C T 4: 106,448,947 G368R probably damaging Het
Ptgr2 G A 12: 84,295,336 probably null Het
Rhebl1 T A 15: 98,878,270 I168F probably damaging Het
Serpina3b A G 12: 104,130,777 T106A probably benign Het
Sh3pxd2b A G 11: 32,422,422 I530V probably benign Het
Skint10 T C 4: 112,746,775 T72A probably benign Het
Slx4 G T 16: 4,001,284 F8L possibly damaging Het
Tiam2 A G 17: 3,448,489 I847V probably benign Het
Tmem200c A G 17: 68,842,009 E529G probably benign Het
Tnpo1 T C 13: 98,856,908 D590G probably damaging Het
Ube2cbp T C 9: 86,372,436 T331A possibly damaging Het
Ugt1a2 T A 1: 88,201,065 S143R probably damaging Het
Zfp58 A T 13: 67,491,293 C360S probably damaging Het
Other mutations in Tdp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Tdp2 APN 13 24840538 missense probably damaging 1.00
IGL01376:Tdp2 APN 13 24836949 splice site probably null
IGL02346:Tdp2 APN 13 24841352 missense possibly damaging 0.86
IGL02455:Tdp2 APN 13 24841262 missense probably damaging 0.97
R0008:Tdp2 UTSW 13 24841350 unclassified probably null
R0008:Tdp2 UTSW 13 24841350 unclassified probably null
R0164:Tdp2 UTSW 13 24838239 missense probably damaging 1.00
R0164:Tdp2 UTSW 13 24838239 missense probably damaging 1.00
R0179:Tdp2 UTSW 13 24840448 missense possibly damaging 0.46
R1939:Tdp2 UTSW 13 24841277 missense probably benign 0.07
R3807:Tdp2 UTSW 13 24831793 nonsense probably null
R3955:Tdp2 UTSW 13 24836099 missense probably benign 0.00
R4943:Tdp2 UTSW 13 24838265 missense probably benign 0.02
R5044:Tdp2 UTSW 13 24831826 missense probably benign 0.00
R5529:Tdp2 UTSW 13 24838236 nonsense probably null
R6235:Tdp2 UTSW 13 24840395 nonsense probably null
R6326:Tdp2 UTSW 13 24840557 missense probably damaging 1.00
R7091:Tdp2 UTSW 13 24838224 missense probably damaging 1.00
R7244:Tdp2 UTSW 13 24841301 missense probably benign 0.02
R7341:Tdp2 UTSW 13 24832076 missense probably benign 0.00
R8010:Tdp2 UTSW 13 24836027 missense probably damaging 1.00
Z1177:Tdp2 UTSW 13 24841251 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGGGTTACCTTCACTCTTTAG -3'
(R):5'- CGCTCAGGGCTTTCTGAAAAG -3'

Sequencing Primer
(F):5'- CGGTCTTCTTGCCGGAAG -3'
(R):5'- CTTTCTGAAAAGCAAAGGCACAAG -3'
Posted On2016-12-20