Incidental Mutation 'R5827:Tnpo1'
ID450228
Institutional Source Beutler Lab
Gene Symbol Tnpo1
Ensembl Gene ENSMUSG00000009470
Gene Nametransportin 1
SynonymsKpnb2, D13Ertd688e
MMRRC Submission 043218-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R5827 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location98839019-98926384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98856908 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 590 (D590G)
Ref Sequence ENSEMBL: ENSMUSP00000105028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109399] [ENSMUST00000109401] [ENSMUST00000179301]
Predicted Effect probably damaging
Transcript: ENSMUST00000109399
AA Change: D582G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105026
Gene: ENSMUSG00000009470
AA Change: D582G

DomainStartEndE-ValueType
IBN_N 33 101 1.53e-6 SMART
low complexity region 350 368 N/A INTRINSIC
low complexity region 393 410 N/A INTRINSIC
Pfam:HEAT_EZ 411 465 4.7e-12 PFAM
Pfam:HEAT 439 469 6.8e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109401
AA Change: D590G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105028
Gene: ENSMUSG00000009470
AA Change: D590G

DomainStartEndE-ValueType
IBN_N 41 109 1.53e-6 SMART
low complexity region 358 376 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
Pfam:HEAT_EZ 419 473 6.6e-15 PFAM
Pfam:HEAT 447 477 1.3e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179301
AA Change: D582G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136917
Gene: ENSMUSG00000009470
AA Change: D582G

DomainStartEndE-ValueType
IBN_N 33 101 1.53e-6 SMART
low complexity region 350 368 N/A INTRINSIC
low complexity region 393 410 N/A INTRINSIC
Pfam:HEAT_EZ 411 465 4.2e-12 PFAM
Pfam:HEAT 439 469 6.1e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224099
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of the karyopherin receptor complex which interacts with nuclear localization signals to target nuclear proteins to the nucleus. The karyopherin receptor complex is a heterodimer of an alpha subunit which recognizes the nuclear localization signal and a beta subunit which docks the complex at nucleoporins. Alternate splicing of this gene results in two transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Agl T C 3: 116,781,054 I34V probably damaging Het
Cavin4 A T 4: 48,672,074 D173V probably damaging Het
Chd9 A G 8: 90,989,450 D884G probably damaging Het
Col6a5 G A 9: 105,928,120 R1196* probably null Het
Disc1 T C 8: 125,135,365 L492P probably damaging Het
Dscam A G 16: 96,649,991 probably null Het
Fbxw4 T C 19: 45,579,657 T26A probably benign Het
Hist1h1t A G 13: 23,696,202 K113E possibly damaging Het
Klhl24 T A 16: 20,120,121 Y475* probably null Het
Map4k3 C T 17: 80,593,283 probably null Het
Mfsd6 T C 1: 52,662,392 E633G probably damaging Het
Mycn G A 12: 12,939,793 R201* probably null Het
Nek11 T C 9: 105,314,745 I155M probably damaging Het
Notch2 G A 3: 98,072,862 V231I possibly damaging Het
Npnt A C 3: 132,906,775 V187G possibly damaging Het
Nr1d2 C A 14: 18,222,248 V8L possibly damaging Het
Nup188 C T 2: 30,339,847 T1359I probably damaging Het
Olfr1029 C A 2: 85,975,306 P21Q probably benign Het
Olfr1277 A T 2: 111,269,921 W149R probably damaging Het
Olfr164 T A 16: 19,286,432 I104L probably benign Het
Olfr957 T A 9: 39,511,058 I221F probably damaging Het
P2rx2 C T 5: 110,340,329 R453Q probably benign Het
Pcdhb7 A G 18: 37,342,024 E71G probably benign Het
Pcdhb9 A T 18: 37,401,958 D335V possibly damaging Het
Pcsk9 C T 4: 106,448,947 G368R probably damaging Het
Ptgr2 G A 12: 84,295,336 probably null Het
Rhebl1 T A 15: 98,878,270 I168F probably damaging Het
Serpina3b A G 12: 104,130,777 T106A probably benign Het
Sh3pxd2b A G 11: 32,422,422 I530V probably benign Het
Skint10 T C 4: 112,746,775 T72A probably benign Het
Slx4 G T 16: 4,001,284 F8L possibly damaging Het
Tdp2 T C 13: 24,831,853 L41P probably damaging Het
Tiam2 A G 17: 3,448,489 I847V probably benign Het
Tmem200c A G 17: 68,842,009 E529G probably benign Het
Ube2cbp T C 9: 86,372,436 T331A possibly damaging Het
Ugt1a2 T A 1: 88,201,065 S143R probably damaging Het
Zfp58 A T 13: 67,491,293 C360S probably damaging Het
Other mutations in Tnpo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Tnpo1 APN 13 98850104 splice site probably benign
IGL02572:Tnpo1 APN 13 98849159 missense probably damaging 1.00
IGL03040:Tnpo1 APN 13 98859955 missense probably damaging 0.99
IGL03237:Tnpo1 APN 13 98863840 missense probably damaging 0.98
IGL03379:Tnpo1 APN 13 98863840 missense probably damaging 0.98
IGL03393:Tnpo1 APN 13 98888473 missense probably damaging 0.99
IGL03405:Tnpo1 APN 13 98863840 missense probably damaging 0.98
IGL03407:Tnpo1 APN 13 98863840 missense probably damaging 0.98
domineight UTSW 13 98867129 frame shift probably null
invert UTSW 13 98855446 missense probably damaging 1.00
R0308:Tnpo1 UTSW 13 98846503 missense probably damaging 0.97
R0465:Tnpo1 UTSW 13 98884634 missense probably damaging 0.97
R0492:Tnpo1 UTSW 13 98855446 missense probably damaging 1.00
R0707:Tnpo1 UTSW 13 98855446 missense probably damaging 1.00
R0732:Tnpo1 UTSW 13 98863812 missense probably damaging 0.99
R1314:Tnpo1 UTSW 13 98860722 missense probably damaging 0.99
R1449:Tnpo1 UTSW 13 98878712 missense probably damaging 0.99
R1468:Tnpo1 UTSW 13 98850157 missense probably benign 0.25
R1468:Tnpo1 UTSW 13 98850157 missense probably benign 0.25
R1488:Tnpo1 UTSW 13 98856907 missense probably damaging 0.98
R1961:Tnpo1 UTSW 13 98852932 missense probably damaging 1.00
R3123:Tnpo1 UTSW 13 98867129 frame shift probably null
R3124:Tnpo1 UTSW 13 98867129 frame shift probably null
R4151:Tnpo1 UTSW 13 98852899 missense probably damaging 1.00
R4272:Tnpo1 UTSW 13 98867129 frame shift probably null
R4274:Tnpo1 UTSW 13 98867129 frame shift probably null
R5154:Tnpo1 UTSW 13 98870305 missense possibly damaging 0.84
R5763:Tnpo1 UTSW 13 98859937 missense possibly damaging 0.54
R5765:Tnpo1 UTSW 13 98859841 missense probably benign 0.08
R6240:Tnpo1 UTSW 13 98863829 missense probably damaging 1.00
R6279:Tnpo1 UTSW 13 98890708 missense possibly damaging 0.90
R6294:Tnpo1 UTSW 13 98890774 missense probably benign 0.03
R7055:Tnpo1 UTSW 13 98855479 missense possibly damaging 0.85
R7509:Tnpo1 UTSW 13 98870243 missense probably benign 0.00
Z1088:Tnpo1 UTSW 13 98860670 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TATACTGTCAAAGAACAAACTGCAG -3'
(R):5'- TAGTAGATCTTGATGGTCTAAGGTAC -3'

Sequencing Primer
(F):5'- TGTCAAAGAACAAACTGCAGAAAGC -3'
(R):5'- ACAATTGCTCCAGATGGG -3'
Posted On2016-12-20