Incidental Mutation 'R0549:Sirt3'
ID45023
Institutional Source Beutler Lab
Gene Symbol Sirt3
Ensembl Gene ENSMUSG00000025486
Gene Namesirtuin 3
SynonymsSir2l3, 2310003L23Rik
MMRRC Submission 038741-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0549 (G1)
Quality Score154
Status Validated
Chromosome7
Chromosomal Location140863666-140882309 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 140869487 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026559] [ENSMUST00000026559] [ENSMUST00000106048] [ENSMUST00000106048] [ENSMUST00000137024] [ENSMUST00000147331] [ENSMUST00000147331] [ENSMUST00000210296] [ENSMUST00000210296] [ENSMUST00000211179] [ENSMUST00000211179]
Predicted Effect probably null
Transcript: ENSMUST00000026559
SMART Domains Protein: ENSMUSP00000026559
Gene: ENSMUSG00000025486

DomainStartEndE-ValueType
Pfam:SIR2 3 184 5.3e-57 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000026559
SMART Domains Protein: ENSMUSP00000026559
Gene: ENSMUSG00000025486

DomainStartEndE-ValueType
Pfam:SIR2 3 184 5.3e-57 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106048
SMART Domains Protein: ENSMUSP00000101663
Gene: ENSMUSG00000025486

DomainStartEndE-ValueType
Pfam:SIR2 3 184 8.7e-57 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106048
SMART Domains Protein: ENSMUSP00000101663
Gene: ENSMUSG00000025486

DomainStartEndE-ValueType
Pfam:SIR2 3 184 8.7e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137024
SMART Domains Protein: ENSMUSP00000114247
Gene: ENSMUSG00000025486

DomainStartEndE-ValueType
Pfam:SIR2 3 178 1.7e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147331
SMART Domains Protein: ENSMUSP00000121151
Gene: ENSMUSG00000025486

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
Pfam:SIR2 80 258 1.9e-54 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147331
SMART Domains Protein: ENSMUSP00000121151
Gene: ENSMUSG00000025486

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
Pfam:SIR2 80 258 1.9e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210296
Predicted Effect probably benign
Transcript: ENSMUST00000210296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210706
Predicted Effect probably null
Transcript: ENSMUST00000211179
Predicted Effect probably null
Transcript: ENSMUST00000211179
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class I of the sirtuin family. Two alternatively spliced transcript variants that encode different proteins have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one null allele exhibit increased systolic blood pressure while mice homozygous for another allele exhibit reduced ATP production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,322,290 F498L probably damaging Het
Adamts6 A T 13: 104,297,255 D64V possibly damaging Het
Agbl2 T C 2: 90,789,843 probably benign Het
Angptl3 A G 4: 99,031,455 S151G probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
C4b G T 17: 34,735,415 L927I probably damaging Het
Ccl3 T C 11: 83,648,336 T66A probably damaging Het
Cdh7 T C 1: 110,108,944 L618P probably damaging Het
Cfap65 T C 1: 74,918,444 T989A probably benign Het
Cnpy4 T C 5: 138,187,637 F18S possibly damaging Het
Col6a5 A G 9: 105,904,579 probably benign Het
Dppa2 G A 16: 48,318,671 R289H probably benign Het
Evx2 T C 2: 74,659,134 T96A probably benign Het
Frmd4a A G 2: 4,603,967 E577G possibly damaging Het
Gcgr G A 11: 120,536,561 G166S probably benign Het
Gm4788 A T 1: 139,739,488 D377E probably damaging Het
Gm5316 T C 6: 122,900,191 noncoding transcript Het
Gria1 G A 11: 57,228,973 R292Q probably damaging Het
Hars2 T A 18: 36,786,208 probably null Het
Hkdc1 T A 10: 62,400,240 T508S probably benign Het
Kif2b A T 11: 91,576,584 I291N probably damaging Het
Lmbrd1 A T 1: 24,744,920 T377S probably benign Het
Lrrc28 A G 7: 67,628,342 probably benign Het
Mmp3 A T 9: 7,455,638 N463I probably benign Het
Myh6 A G 14: 54,958,608 F578S probably damaging Het
Ncbp1 T A 4: 46,168,476 M608K possibly damaging Het
Nf1 T C 11: 79,468,771 F1412L probably damaging Het
Nlrp5 T A 7: 23,441,802 W1083R probably damaging Het
Nrsn1 T C 13: 25,262,258 Y45C probably benign Het
Olfr401 T G 11: 74,121,475 M62R probably damaging Het
Osbpl7 G T 11: 97,067,542 R881L probably damaging Het
Papss1 A G 3: 131,619,213 E456G possibly damaging Het
Pbxip1 T A 3: 89,443,592 probably benign Het
Pcca A G 14: 122,638,377 probably benign Het
Pde1a T A 2: 79,865,070 N511I probably damaging Het
Prpf39 A T 12: 65,056,256 I435F probably benign Het
Rnf213 C T 11: 119,465,082 T4117M probably damaging Het
Sel1l2 A T 2: 140,265,882 M216K probably damaging Het
Sidt2 A G 9: 45,953,119 probably null Het
Smpd4 T C 16: 17,639,312 V378A probably benign Het
Svil T A 18: 5,064,566 S642T possibly damaging Het
Tcp10a A G 17: 7,326,551 K92E probably benign Het
Tmem144 T C 3: 79,822,744 D233G probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnik T C 3: 28,570,920 S335P possibly damaging Het
Ush2a T C 1: 188,946,953 L4786P probably damaging Het
Utp11 A T 4: 124,686,079 probably benign Het
Vmn1r67 A G 7: 10,447,714 N241D probably damaging Het
Vmn2r11 A T 5: 109,052,097 C497S possibly damaging Het
Other mutations in Sirt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Sirt3 APN 7 140864093 splice site probably benign
IGL03100:Sirt3 APN 7 140865117 missense probably damaging 1.00
R0478:Sirt3 UTSW 7 140878114 missense probably benign
R1101:Sirt3 UTSW 7 140869628 missense possibly damaging 0.94
R3983:Sirt3 UTSW 7 140878112 nonsense probably null
R4461:Sirt3 UTSW 7 140865000 missense possibly damaging 0.74
R5369:Sirt3 UTSW 7 140869493 missense probably damaging 1.00
R5452:Sirt3 UTSW 7 140865015 missense probably damaging 1.00
R7313:Sirt3 UTSW 7 140878126 missense
R7755:Sirt3 UTSW 7 140878050 missense
Z1176:Sirt3 UTSW 7 140881844 missense not run
Predicted Primers PCR Primer
(F):5'- TGTGCCGAGATCAGTCCTTTCAGC -3'
(R):5'- AAAGCCACATGGGGACCATTACAG -3'

Sequencing Primer
(F):5'- ATCAGTCCTTTCAGCCCTGC -3'
(R):5'- TGTTCGACATCTCCTTGAAGAG -3'
Posted On2013-06-11