Incidental Mutation 'R5827:Olfr164'
ID450233
Institutional Source Beutler Lab
Gene Symbol Olfr164
Ensembl Gene ENSMUSG00000050742
Gene Nameolfactory receptor 164
SynonymsGA_x54KRFPKG5P-15738260-15737319, MOR279-2
MMRRC Submission 043218-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R5827 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location19284104-19314064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19286432 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 104 (I104L)
Ref Sequence ENSEMBL: ENSMUSP00000149971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056727] [ENSMUST00000216157]
Predicted Effect probably benign
Transcript: ENSMUST00000056727
AA Change: I104L

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000056970
Gene: ENSMUSG00000050742
AA Change: I104L

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 2.3e-49 PFAM
Pfam:7TM_GPCR_Srsx 38 308 8.2e-8 PFAM
Pfam:7tm_1 44 293 5.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216157
AA Change: I104L

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Agl T C 3: 116,781,054 I34V probably damaging Het
Cavin4 A T 4: 48,672,074 D173V probably damaging Het
Chd9 A G 8: 90,989,450 D884G probably damaging Het
Col6a5 G A 9: 105,928,120 R1196* probably null Het
Disc1 T C 8: 125,135,365 L492P probably damaging Het
Dscam A G 16: 96,649,991 probably null Het
Fbxw4 T C 19: 45,579,657 T26A probably benign Het
Hist1h1t A G 13: 23,696,202 K113E possibly damaging Het
Klhl24 T A 16: 20,120,121 Y475* probably null Het
Map4k3 C T 17: 80,593,283 probably null Het
Mfsd6 T C 1: 52,662,392 E633G probably damaging Het
Mycn G A 12: 12,939,793 R201* probably null Het
Nek11 T C 9: 105,314,745 I155M probably damaging Het
Notch2 G A 3: 98,072,862 V231I possibly damaging Het
Npnt A C 3: 132,906,775 V187G possibly damaging Het
Nr1d2 C A 14: 18,222,248 V8L possibly damaging Het
Nup188 C T 2: 30,339,847 T1359I probably damaging Het
Olfr1029 C A 2: 85,975,306 P21Q probably benign Het
Olfr1277 A T 2: 111,269,921 W149R probably damaging Het
Olfr957 T A 9: 39,511,058 I221F probably damaging Het
P2rx2 C T 5: 110,340,329 R453Q probably benign Het
Pcdhb7 A G 18: 37,342,024 E71G probably benign Het
Pcdhb9 A T 18: 37,401,958 D335V possibly damaging Het
Pcsk9 C T 4: 106,448,947 G368R probably damaging Het
Ptgr2 G A 12: 84,295,336 probably null Het
Rhebl1 T A 15: 98,878,270 I168F probably damaging Het
Serpina3b A G 12: 104,130,777 T106A probably benign Het
Sh3pxd2b A G 11: 32,422,422 I530V probably benign Het
Skint10 T C 4: 112,746,775 T72A probably benign Het
Slx4 G T 16: 4,001,284 F8L possibly damaging Het
Tdp2 T C 13: 24,831,853 L41P probably damaging Het
Tiam2 A G 17: 3,448,489 I847V probably benign Het
Tmem200c A G 17: 68,842,009 E529G probably benign Het
Tnpo1 T C 13: 98,856,908 D590G probably damaging Het
Ube2cbp T C 9: 86,372,436 T331A possibly damaging Het
Ugt1a2 T A 1: 88,201,065 S143R probably damaging Het
Zfp58 A T 13: 67,491,293 C360S probably damaging Het
Other mutations in Olfr164
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Olfr164 APN 16 19286700 missense probably benign 0.01
IGL01569:Olfr164 APN 16 19286660 missense probably benign 0.28
IGL01619:Olfr164 APN 16 19286159 missense probably damaging 1.00
IGL02101:Olfr164 APN 16 19286613 missense probably benign
IGL02201:Olfr164 APN 16 19286462 missense probably benign 0.03
IGL02730:Olfr164 APN 16 19286682 missense probably benign 0.00
IGL03228:Olfr164 APN 16 19286390 missense probably damaging 1.00
R1566:Olfr164 UTSW 16 19286327 missense possibly damaging 0.76
R1817:Olfr164 UTSW 16 19285877 missense probably damaging 1.00
R1870:Olfr164 UTSW 16 19286607 missense probably damaging 1.00
R1918:Olfr164 UTSW 16 19286302 missense probably benign 0.03
R2202:Olfr164 UTSW 16 19286297 missense probably benign 0.03
R2265:Olfr164 UTSW 16 19286555 missense probably damaging 1.00
R3792:Olfr164 UTSW 16 19285946 missense possibly damaging 0.54
R4285:Olfr164 UTSW 16 19285964 missense probably damaging 1.00
R4961:Olfr164 UTSW 16 19285976 missense probably damaging 1.00
R5022:Olfr164 UTSW 16 19286059 missense probably damaging 1.00
R5432:Olfr164 UTSW 16 19286089 missense probably benign 0.06
R6154:Olfr164 UTSW 16 19286431 missense probably damaging 0.99
R6188:Olfr164 UTSW 16 19286557 missense probably damaging 1.00
R6367:Olfr164 UTSW 16 19286072 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTATTTCTCTGGCACCAC -3'
(R):5'- GCCTTCATAGGAAATTCTATCATGG -3'

Sequencing Primer
(F):5'- GGTATTTCTCTGGCACCACAATATG -3'
(R):5'- ATCATGGTGATTCTCATCTACTTGG -3'
Posted On2016-12-20