Incidental Mutation 'R5827:Fbxw4'
ID450241
Institutional Source Beutler Lab
Gene Symbol Fbxw4
Ensembl Gene ENSMUSG00000040913
Gene NameF-box and WD-40 domain protein 4
Synonymsdactylyn, Fbw4, dactylin
MMRRC Submission 043218-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.602) question?
Stock #R5827 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location45578254-45660312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45579657 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 26 (T26A)
Ref Sequence ENSEMBL: ENSMUSP00000124675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046869] [ENSMUST00000047057] [ENSMUST00000160003] [ENSMUST00000160018] [ENSMUST00000160438] [ENSMUST00000162433] [ENSMUST00000162879]
Predicted Effect probably benign
Transcript: ENSMUST00000046869
AA Change: T323A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000036505
Gene: ENSMUSG00000040913
AA Change: T323A

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
FBOX 29 69 1.47e-2 SMART
WD40 150 187 3.45e-1 SMART
WD40 189 226 2.24e-2 SMART
WD40 232 274 8.91e-1 SMART
WD40 277 318 5.52e0 SMART
WD40 323 363 1.67e-1 SMART
Blast:WD40 366 406 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000047057
SMART Domains Protein: ENSMUSP00000045683
Gene: ENSMUSG00000041035

DomainStartEndE-ValueType
Pfam:DPCD 6 195 4.5e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160003
SMART Domains Protein: ENSMUSP00000124604
Gene: ENSMUSG00000040913

DomainStartEndE-ValueType
Blast:WD40 1 36 2e-20 BLAST
SCOP:d1fwxa2 8 62 4e-7 SMART
Blast:WD40 39 79 1e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160018
AA Change: T26A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000125641
Gene: ENSMUSG00000040913
AA Change: T26A

DomainStartEndE-ValueType
Blast:WD40 1 21 8e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160438
AA Change: T98A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000125136
Gene: ENSMUSG00000040913
AA Change: T98A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
WD40 52 93 5.52e0 SMART
WD40 98 138 1.67e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161373
Predicted Effect probably benign
Transcript: ENSMUST00000162433
AA Change: T26A

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124998
Gene: ENSMUSG00000040913
AA Change: T26A

DomainStartEndE-ValueType
Blast:WD40 1 21 5e-7 BLAST
WD40 26 66 1.67e-1 SMART
Blast:WD40 69 109 3e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162879
AA Change: T26A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124675
Gene: ENSMUSG00000040913
AA Change: T26A

DomainStartEndE-ValueType
Blast:WD40 1 21 4e-7 BLAST
WD40 26 66 1.67e-1 SMART
Blast:WD40 69 102 8e-9 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the F-box/WD-40 gene family, which recruit specific target proteins through their WD-40 protein-protein binding domains for ubiquitin mediated degradation. In mouse, a highly similar protein is thought to be responsible for maintaining the apical ectodermal ridge of developing limb buds; disruption of the mouse gene results in the absence of central digits, underdeveloped or absent metacarpal/metatarsal bones and syndactyly. This phenotype is remarkably similar to split hand-split foot malformation in humans, a clinically heterogeneous condition with a variety of modes of transmission. An autosomal recessive form has been mapped to the chromosomal region where this gene is located, and complex rearrangements involving duplications of this gene and others have been associated with the condition. A pseudogene of this locus has been mapped to one of the introns of the BCR gene on chromosome 22. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous null mutation lack feet except for a single fused digit and die prenatally. Heterozygotes, in the presence of a recessive modifying allele, show loss of digits, frequently with fused metatarsal and metacarpal bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Agl T C 3: 116,781,054 I34V probably damaging Het
Cavin4 A T 4: 48,672,074 D173V probably damaging Het
Chd9 A G 8: 90,989,450 D884G probably damaging Het
Col6a5 G A 9: 105,928,120 R1196* probably null Het
Disc1 T C 8: 125,135,365 L492P probably damaging Het
Dscam A G 16: 96,649,991 probably null Het
Hist1h1t A G 13: 23,696,202 K113E possibly damaging Het
Klhl24 T A 16: 20,120,121 Y475* probably null Het
Map4k3 C T 17: 80,593,283 probably null Het
Mfsd6 T C 1: 52,662,392 E633G probably damaging Het
Mycn G A 12: 12,939,793 R201* probably null Het
Nek11 T C 9: 105,314,745 I155M probably damaging Het
Notch2 G A 3: 98,072,862 V231I possibly damaging Het
Npnt A C 3: 132,906,775 V187G possibly damaging Het
Nr1d2 C A 14: 18,222,248 V8L possibly damaging Het
Nup188 C T 2: 30,339,847 T1359I probably damaging Het
Olfr1029 C A 2: 85,975,306 P21Q probably benign Het
Olfr1277 A T 2: 111,269,921 W149R probably damaging Het
Olfr164 T A 16: 19,286,432 I104L probably benign Het
Olfr957 T A 9: 39,511,058 I221F probably damaging Het
P2rx2 C T 5: 110,340,329 R453Q probably benign Het
Pcdhb7 A G 18: 37,342,024 E71G probably benign Het
Pcdhb9 A T 18: 37,401,958 D335V possibly damaging Het
Pcsk9 C T 4: 106,448,947 G368R probably damaging Het
Ptgr2 G A 12: 84,295,336 probably null Het
Rhebl1 T A 15: 98,878,270 I168F probably damaging Het
Serpina3b A G 12: 104,130,777 T106A probably benign Het
Sh3pxd2b A G 11: 32,422,422 I530V probably benign Het
Skint10 T C 4: 112,746,775 T72A probably benign Het
Slx4 G T 16: 4,001,284 F8L possibly damaging Het
Tdp2 T C 13: 24,831,853 L41P probably damaging Het
Tiam2 A G 17: 3,448,489 I847V probably benign Het
Tmem200c A G 17: 68,842,009 E529G probably benign Het
Tnpo1 T C 13: 98,856,908 D590G probably damaging Het
Ube2cbp T C 9: 86,372,436 T331A possibly damaging Het
Ugt1a2 T A 1: 88,201,065 S143R probably damaging Het
Zfp58 A T 13: 67,491,293 C360S probably damaging Het
Other mutations in Fbxw4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Fbxw4 APN 19 45640516 missense probably benign 0.09
IGL03089:Fbxw4 APN 19 45591721 splice site probably benign
R4566:Fbxw4 UTSW 19 45591786 missense probably benign 0.24
R6175:Fbxw4 UTSW 19 45636327 missense probably benign 0.00
R6829:Fbxw4 UTSW 19 45636374 missense possibly damaging 0.46
R6862:Fbxw4 UTSW 19 45582748 missense probably benign 0.01
R7528:Fbxw4 UTSW 19 45660010 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGACCCATTGTAGAGGCTC -3'
(R):5'- GGCTTGCCATATCTTCCCTGAG -3'

Sequencing Primer
(F):5'- TGTAGAGGCTCTAAGAAATGTCTGC -3'
(R):5'- TCCTCTTCAGGAGCACCCAG -3'
Posted On2016-12-20