Incidental Mutation 'R5828:Ces2a'
ID 450268
Institutional Source Beutler Lab
Gene Symbol Ces2a
Ensembl Gene ENSMUSG00000055730
Gene Name carboxylesterase 2A
Synonyms 9130231C15Rik, Ces6
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R5828 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 105460635-105468266 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 105465956 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 363 (T363N)
Ref Sequence ENSEMBL: ENSMUSP00000034346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034346] [ENSMUST00000161824] [ENSMUST00000164182]
AlphaFold Q8QZR3
Predicted Effect probably benign
Transcript: ENSMUST00000034346
AA Change: T363N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000034346
Gene: ENSMUSG00000055730
AA Change: T363N

DomainStartEndE-ValueType
Pfam:COesterase 9 537 1.2e-171 PFAM
Pfam:Abhydrolase_3 142 267 2.9e-11 PFAM
Pfam:Peptidase_S9 156 347 7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159303
Predicted Effect probably benign
Transcript: ENSMUST00000161824
Predicted Effect probably benign
Transcript: ENSMUST00000164182
AA Change: T330N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000127346
Gene: ENSMUSG00000055730
AA Change: T330N

DomainStartEndE-ValueType
Pfam:COesterase 8 276 5e-110 PFAM
Pfam:Abhydrolase_3 142 267 2.6e-11 PFAM
Pfam:Peptidase_S9 156 275 3e-7 PFAM
Pfam:COesterase 259 504 8.3e-47 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,432,144 (GRCm39) D95G unknown Het
Arl10 T A 13: 54,726,768 (GRCm39) V182E probably damaging Het
Cacna1g T G 11: 94,347,980 (GRCm39) S703R probably damaging Het
Col14a1 G A 15: 55,300,372 (GRCm39) V967I unknown Het
Col22a1 A T 15: 71,881,340 (GRCm39) F4I probably benign Het
D630045J12Rik A G 6: 38,173,302 (GRCm39) W289R possibly damaging Het
Disc1 A G 8: 125,977,763 (GRCm39) Q793R probably damaging Het
Dnhd1 C T 7: 105,369,388 (GRCm39) T4337I probably benign Het
Eif2b5 T A 16: 20,321,536 (GRCm39) V363D possibly damaging Het
Emsy T C 7: 98,242,699 (GRCm39) T1147A probably benign Het
Epg5 T A 18: 78,064,066 (GRCm39) Y2048N probably damaging Het
Fchsd1 C T 18: 38,092,926 (GRCm39) probably benign Het
Foxred1 A G 9: 35,121,492 (GRCm39) probably benign Het
Gpaa1 T C 15: 76,216,471 (GRCm39) probably benign Het
Gria4 A C 9: 4,432,832 (GRCm39) L784V probably damaging Het
Homer3 A G 8: 70,738,956 (GRCm39) Y105C probably benign Het
Hpgd T C 8: 56,772,106 (GRCm39) S193P probably benign Het
Irf1 T A 11: 53,666,762 (GRCm39) W247R probably benign Het
Lpgat1 A G 1: 191,508,494 (GRCm39) Q344R possibly damaging Het
Luzp1 T C 4: 136,267,993 (GRCm39) V72A probably damaging Het
Malrd1 G A 2: 15,531,464 (GRCm39) V8M probably benign Het
Msmo1 T C 8: 65,172,144 (GRCm39) H253R probably damaging Het
Nom1 A G 5: 29,640,124 (GRCm39) K150R possibly damaging Het
Onecut1 A G 9: 74,770,042 (GRCm39) E155G probably benign Het
Or12k7 A G 2: 36,959,001 (GRCm39) H228R probably benign Het
Or14c46 T A 7: 85,918,728 (GRCm39) M90L probably benign Het
Or5p59 T C 7: 107,703,005 (GRCm39) V163A possibly damaging Het
Osbpl10 G A 9: 114,890,944 (GRCm39) V111M probably damaging Het
Pcdhgb6 T C 18: 37,877,457 (GRCm39) S722P probably benign Het
Plin4 T A 17: 56,414,064 (GRCm39) D187V probably damaging Het
Pmf1 T C 3: 88,303,294 (GRCm39) E89G possibly damaging Het
Polr1d A T 5: 147,014,408 (GRCm39) probably benign Het
Ppp1r9a T C 6: 5,158,200 (GRCm39) Y1006H probably damaging Het
Ppp2r5c A G 12: 110,537,134 (GRCm39) K420E probably benign Het
Prdx1 T C 4: 116,551,006 (GRCm39) L159P probably damaging Het
Psmd6 G T 14: 14,119,990 (GRCm38) D39E probably benign Het
Rffl T C 11: 82,709,244 (GRCm39) K60E probably damaging Het
Rspo2 A T 15: 42,939,283 (GRCm39) L169Q probably damaging Het
Sbf1 T A 15: 89,172,837 (GRCm39) D1892V probably damaging Het
Sbno2 G A 10: 79,902,424 (GRCm39) S475F possibly damaging Het
Serpina3i T A 12: 104,231,474 (GRCm39) V37E probably benign Het
Siglecf G A 7: 43,001,137 (GRCm39) C35Y probably damaging Het
Slc22a27 G T 19: 7,903,767 (GRCm39) D123E probably damaging Het
Smim23 T A 11: 32,770,592 (GRCm39) K105* probably null Het
Soat1 C T 1: 156,265,318 (GRCm39) S348N probably benign Het
Sp2 C T 11: 96,851,811 (GRCm39) probably benign Het
St14 T A 9: 31,002,803 (GRCm39) H700L probably damaging Het
St3gal1 T A 15: 66,985,634 (GRCm39) K7* probably null Het
Tgm1 T C 14: 55,943,011 (GRCm39) K610E probably benign Het
Tob1 T A 11: 94,104,583 (GRCm39) Y40N probably damaging Het
Tob1 T A 11: 94,104,585 (GRCm39) Y40* probably null Het
Trpc4ap A G 2: 155,477,130 (GRCm39) probably benign Het
Ttc9 C T 12: 81,678,450 (GRCm39) P91L probably benign Het
Zbtb18 T C 1: 177,275,446 (GRCm39) S269P probably damaging Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Zfyve16 A T 13: 92,650,410 (GRCm39) V858E probably damaging Het
Other mutations in Ces2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Ces2a APN 8 105,468,047 (GRCm39) makesense probably null
IGL02135:Ces2a APN 8 105,466,813 (GRCm39) missense probably benign 0.00
IGL02529:Ces2a APN 8 105,463,851 (GRCm39) splice site probably benign
IGL02625:Ces2a APN 8 105,466,910 (GRCm39) critical splice donor site probably null
IGL02869:Ces2a APN 8 105,465,691 (GRCm39) missense probably damaging 1.00
IGL03265:Ces2a APN 8 105,464,075 (GRCm39) missense possibly damaging 0.55
IGL03349:Ces2a APN 8 105,460,712 (GRCm39) missense probably damaging 0.99
R0010:Ces2a UTSW 8 105,468,028 (GRCm39) missense probably benign 0.00
R0318:Ces2a UTSW 8 105,467,456 (GRCm39) missense probably damaging 1.00
R0477:Ces2a UTSW 8 105,464,169 (GRCm39) missense probably damaging 0.99
R0561:Ces2a UTSW 8 105,464,165 (GRCm39) missense probably benign 0.35
R0619:Ces2a UTSW 8 105,462,742 (GRCm39) missense probably benign 0.00
R1665:Ces2a UTSW 8 105,464,187 (GRCm39) splice site probably benign
R1737:Ces2a UTSW 8 105,467,456 (GRCm39) missense probably damaging 0.98
R2266:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2267:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2269:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2288:Ces2a UTSW 8 105,464,069 (GRCm39) missense probably damaging 1.00
R2656:Ces2a UTSW 8 105,462,766 (GRCm39) missense probably benign 0.00
R3176:Ces2a UTSW 8 105,466,010 (GRCm39) splice site probably benign
R3906:Ces2a UTSW 8 105,465,940 (GRCm39) missense probably benign 0.00
R4344:Ces2a UTSW 8 105,463,766 (GRCm39) missense probably damaging 1.00
R4708:Ces2a UTSW 8 105,463,938 (GRCm39) missense probably benign 0.14
R4780:Ces2a UTSW 8 105,463,840 (GRCm39) missense probably damaging 1.00
R5434:Ces2a UTSW 8 105,464,041 (GRCm39) missense probably damaging 0.98
R5763:Ces2a UTSW 8 105,462,756 (GRCm39) missense probably benign 0.00
R6359:Ces2a UTSW 8 105,462,710 (GRCm39) missense probably benign 0.00
R6440:Ces2a UTSW 8 105,467,954 (GRCm39) missense probably benign 0.12
R7066:Ces2a UTSW 8 105,466,880 (GRCm39) missense probably damaging 0.99
R7267:Ces2a UTSW 8 105,465,672 (GRCm39) missense probably benign 0.20
R7395:Ces2a UTSW 8 105,466,273 (GRCm39) missense probably benign 0.35
R7455:Ces2a UTSW 8 105,464,154 (GRCm39) missense probably damaging 1.00
R7457:Ces2a UTSW 8 105,464,021 (GRCm39) missense possibly damaging 0.87
R7567:Ces2a UTSW 8 105,467,930 (GRCm39) missense probably benign 0.01
R7683:Ces2a UTSW 8 105,463,744 (GRCm39) missense probably benign 0.00
R8328:Ces2a UTSW 8 105,463,998 (GRCm39) missense probably damaging 1.00
R8336:Ces2a UTSW 8 105,465,665 (GRCm39) missense probably damaging 0.97
R9183:Ces2a UTSW 8 105,460,774 (GRCm39) missense possibly damaging 0.95
R9794:Ces2a UTSW 8 105,467,896 (GRCm39) missense probably benign 0.16
X0022:Ces2a UTSW 8 105,462,774 (GRCm39) missense probably damaging 1.00
Z1176:Ces2a UTSW 8 105,461,482 (GRCm39) missense probably damaging 1.00
Z1176:Ces2a UTSW 8 105,460,638 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CACAGATGAATGTGGCTGGG -3'
(R):5'- TGTATGTAAGGAATGCAGCCAG -3'

Sequencing Primer
(F):5'- GGAGTCCCCATGGTGAGAC -3'
(R):5'- AGAAGCTTTGCAGTGATCCC -3'
Posted On 2016-12-20