Incidental Mutation 'R5828:Arl10'
ID450287
Institutional Source Beutler Lab
Gene Symbol Arl10
Ensembl Gene ENSMUSG00000025870
Gene NameADP-ribosylation factor-like 10
SynonymsArl10a, ARL10, Arm1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5828 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location54575015-54581128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54578955 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 182 (V182E)
Ref Sequence ENSEMBL: ENSMUSP00000026988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026988] [ENSMUST00000156024]
Predicted Effect probably damaging
Transcript: ENSMUST00000026988
AA Change: V182E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026988
Gene: ENSMUSG00000025870
AA Change: V182E

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
Pfam:Arf 70 231 6.6e-38 PFAM
Pfam:SRPRB 74 203 9e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135354
Predicted Effect unknown
Transcript: ENSMUST00000142246
AA Change: V48E
SMART Domains Protein: ENSMUSP00000114680
Gene: ENSMUSG00000025870
AA Change: V48E

DomainStartEndE-ValueType
Pfam:Arf 1 54 4.3e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156024
AA Change: V182E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116506
Gene: ENSMUSG00000025870
AA Change: V182E

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
Pfam:Arf 70 191 7.7e-32 PFAM
Pfam:SRPRB 74 194 6e-7 PFAM
Pfam:Miro 78 186 3e-11 PFAM
Meta Mutation Damage Score 0.234 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,601,800 D95G unknown Het
Cacna1g T G 11: 94,457,154 S703R probably damaging Het
Ces2a C A 8: 104,739,324 T363N probably benign Het
Col14a1 G A 15: 55,436,976 V967I unknown Het
Col22a1 A T 15: 72,009,491 F4I probably benign Het
D630045J12Rik A G 6: 38,196,367 W289R possibly damaging Het
Disc1 A G 8: 125,251,024 Q793R probably damaging Het
Dnhd1 C T 7: 105,720,181 T4337I probably benign Het
Eif2b5 T A 16: 20,502,786 V363D possibly damaging Het
Emsy T C 7: 98,593,492 T1147A probably benign Het
Epg5 T A 18: 78,020,851 Y2048N probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Foxred1 A G 9: 35,210,196 probably benign Het
Gpaa1 T C 15: 76,332,271 probably benign Het
Gria4 A C 9: 4,432,832 L784V probably damaging Het
Homer3 A G 8: 70,286,306 Y105C probably benign Het
Hpgd T C 8: 56,319,071 S193P probably benign Het
Irf1 T A 11: 53,775,936 W247R probably benign Het
Lpgat1 A G 1: 191,776,382 Q344R possibly damaging Het
Luzp1 T C 4: 136,540,682 V72A probably damaging Het
Malrd1 G A 2: 15,526,653 V8M probably benign Het
Msmo1 T C 8: 64,719,110 H253R probably damaging Het
Nom1 A G 5: 29,435,126 K150R possibly damaging Het
Olfr310 T A 7: 86,269,520 M90L probably benign Het
Olfr360 A G 2: 37,068,989 H228R probably benign Het
Olfr483 T C 7: 108,103,798 V163A possibly damaging Het
Onecut1 A G 9: 74,862,760 E155G probably benign Het
Osbpl10 G A 9: 115,061,876 V111M probably damaging Het
Pcdhgb6 T C 18: 37,744,404 S722P probably benign Het
Plin4 T A 17: 56,107,064 D187V probably damaging Het
Pmf1 T C 3: 88,395,987 E89G possibly damaging Het
Polr1d A T 5: 147,077,598 probably benign Het
Ppp1r9a T C 6: 5,158,200 Y1006H probably damaging Het
Ppp2r5c A G 12: 110,570,700 K420E probably benign Het
Prdx1 T C 4: 116,693,809 L159P probably damaging Het
Psmd6 G T 14: 14,119,990 D39E probably benign Het
Rffl T C 11: 82,818,418 K60E probably damaging Het
Rspo2 A T 15: 43,075,887 L169Q probably damaging Het
Sbf1 T A 15: 89,288,634 D1892V probably damaging Het
Sbno2 G A 10: 80,066,590 S475F possibly damaging Het
Serpina3i T A 12: 104,265,215 V37E probably benign Het
Siglecf G A 7: 43,351,713 C35Y probably damaging Het
Slc22a27 G T 19: 7,926,402 D123E probably damaging Het
Smim23 T A 11: 32,820,592 K105* probably null Het
Soat1 C T 1: 156,437,748 S348N probably benign Het
Sp2 C T 11: 96,960,985 probably benign Het
St14 T A 9: 31,091,507 H700L probably damaging Het
St3gal1 T A 15: 67,113,785 K7* probably null Het
Tgm1 T C 14: 55,705,554 K610E probably benign Het
Tob1 T A 11: 94,213,757 Y40N probably damaging Het
Tob1 T A 11: 94,213,759 Y40* probably null Het
Trpc4ap A G 2: 155,635,210 probably benign Het
Ttc9 C T 12: 81,631,676 P91L probably benign Het
Zbtb18 T C 1: 177,447,880 S269P probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfyve16 A T 13: 92,513,902 V858E probably damaging Het
Other mutations in Arl10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02150:Arl10 APN 13 54578849 missense probably damaging 1.00
IGL02801:Arl10 APN 13 54575883 missense probably benign 0.17
IGL03114:Arl10 APN 13 54575766 unclassified probably benign
R0015:Arl10 UTSW 13 54575957 splice site probably benign
R0976:Arl10 UTSW 13 54575808 unclassified probably benign
R1223:Arl10 UTSW 13 54578931 missense probably damaging 1.00
R2125:Arl10 UTSW 13 54579124 splice site probably null
R2239:Arl10 UTSW 13 54575149 missense probably benign 0.23
R2380:Arl10 UTSW 13 54575149 missense probably benign 0.23
R6222:Arl10 UTSW 13 54578831 missense probably damaging 0.99
R6602:Arl10 UTSW 13 54578937 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTTAGGATCCGGAAGTG -3'
(R):5'- TGGCATCACATCTGTAAAGGG -3'

Sequencing Primer
(F):5'- ATGCTACAGGGAGCTCTGC -3'
(R):5'- CATCACATCTGTAAAGGGTAACAG -3'
Posted On2016-12-20