Mutagenetix > Incidental Mutations

Incidental Mutation 'R5828:Col22a1'

450294

Institutional Source

Beutler Lab

Gene Symbol

Col22a1

Ensembl Gene

ENSMUSG00000079022

Gene Name

collagen, type XXII, alpha 1

Synonyms

C80743, 2310067L16Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5828 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71795795-72034227 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 72009491 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 4 (F4I)

Ref Sequence

ENSEMBL: ENSMUSP00000125069 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159993]

Predicted Effect

probably benign
Transcript: ENSMUST00000159993
AA Change: F4I

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000125069
Gene: ENSMUSG00000079022
AA Change: F4I

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
VWA	45	227	1.35e-51	SMART
TSPN	248	436	1.26e-33	SMART
low complexity region	454	470	N/A	INTRINSIC
internal_repeat_3	494	555	1.96e-13	PROSPERO
internal_repeat_1	496	643	1.49e-19	PROSPERO
low complexity region	644	657	N/A	INTRINSIC
low complexity region	673	707	N/A	INTRINSIC
Pfam:Collagen	751	823	1.5e-9	PFAM
Pfam:Collagen	810	863	2.3e-10	PFAM
Pfam:Collagen	869	931	4.8e-11	PFAM
Pfam:Collagen	926	990	1.1e-10	PFAM
Pfam:Collagen	1031	1087	1.7e-10	PFAM
Pfam:Collagen	1104	1162	1.8e-11	PFAM
low complexity region	1173	1227	N/A	INTRINSIC
low complexity region	1236	1251	N/A	INTRINSIC
internal_repeat_2	1257	1348	3.25e-18	PROSPERO
internal_repeat_4	1268	1347	9.67e-7	PROSPERO
Pfam:Collagen	1389	1448	4e-10	PFAM
Pfam:Collagen	1481	1540	2.6e-9	PFAM
low complexity region	1546	1558	N/A	INTRINSIC
low complexity region	1580	1590	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL22A1, a member of the FACIT (fibrillar-associated collagens with interrupted triple helices) subgroup of the collagen protein family, specifically localizes to tissue junctions (Koch et al., 2004 [PubMed 15016833]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933409G03Rik	A	G	2: 68,601,800	D95G	unknown	Het
Arl10	T	A	13: 54,578,955	V182E	probably damaging	Het
Cacna1g	T	G	11: 94,457,154	S703R	probably damaging	Het
Ces2a	C	A	8: 104,739,324	T363N	probably benign	Het
Col14a1	G	A	15: 55,436,976	V967I	unknown	Het
D630045J12Rik	A	G	6: 38,196,367	W289R	possibly damaging	Het
Disc1	A	G	8: 125,251,024	Q793R	probably damaging	Het
Dnhd1	C	T	7: 105,720,181	T4337I	probably benign	Het
Eif2b5	T	A	16: 20,502,786	V363D	possibly damaging	Het
Emsy	T	C	7: 98,593,492	T1147A	probably benign	Het
Epg5	T	A	18: 78,020,851	Y2048N	probably damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Foxred1	A	G	9: 35,210,196		probably benign	Het
Gpaa1	T	C	15: 76,332,271		probably benign	Het
Gria4	A	C	9: 4,432,832	L784V	probably damaging	Het
Homer3	A	G	8: 70,286,306	Y105C	probably benign	Het
Hpgd	T	C	8: 56,319,071	S193P	probably benign	Het
Irf1	T	A	11: 53,775,936	W247R	probably benign	Het
Lpgat1	A	G	1: 191,776,382	Q344R	possibly damaging	Het
Luzp1	T	C	4: 136,540,682	V72A	probably damaging	Het
Malrd1	G	A	2: 15,526,653	V8M	probably benign	Het
Msmo1	T	C	8: 64,719,110	H253R	probably damaging	Het
Nom1	A	G	5: 29,435,126	K150R	possibly damaging	Het
Olfr310	T	A	7: 86,269,520	M90L	probably benign	Het
Olfr360	A	G	2: 37,068,989	H228R	probably benign	Het
Olfr483	T	C	7: 108,103,798	V163A	possibly damaging	Het
Onecut1	A	G	9: 74,862,760	E155G	probably benign	Het
Osbpl10	G	A	9: 115,061,876	V111M	probably damaging	Het
Pcdhgb6	T	C	18: 37,744,404	S722P	probably benign	Het
Plin4	T	A	17: 56,107,064	D187V	probably damaging	Het
Pmf1	T	C	3: 88,395,987	E89G	possibly damaging	Het
Polr1d	A	T	5: 147,077,598		probably benign	Het
Ppp1r9a	T	C	6: 5,158,200	Y1006H	probably damaging	Het
Ppp2r5c	A	G	12: 110,570,700	K420E	probably benign	Het
Prdx1	T	C	4: 116,693,809	L159P	probably damaging	Het
Psmd6	G	T	14: 14,119,990	D39E	probably benign	Het
Rffl	T	C	11: 82,818,418	K60E	probably damaging	Het
Rspo2	A	T	15: 43,075,887	L169Q	probably damaging	Het
Sbf1	T	A	15: 89,288,634	D1892V	probably damaging	Het
Sbno2	G	A	10: 80,066,590	S475F	possibly damaging	Het
Serpina3i	T	A	12: 104,265,215	V37E	probably benign	Het
Siglecf	G	A	7: 43,351,713	C35Y	probably damaging	Het
Slc22a27	G	T	19: 7,926,402	D123E	probably damaging	Het
Smim23	T	A	11: 32,820,592	K105*	probably null	Het
Soat1	C	T	1: 156,437,748	S348N	probably benign	Het
Sp2	C	T	11: 96,960,985		probably benign	Het
St14	T	A	9: 31,091,507	H700L	probably damaging	Het
St3gal1	T	A	15: 67,113,785	K7*	probably null	Het
Tgm1	T	C	14: 55,705,554	K610E	probably benign	Het
Tob1	T	A	11: 94,213,757	Y40N	probably damaging	Het
Tob1	T	A	11: 94,213,759	Y40*	probably null	Het
Trpc4ap	A	G	2: 155,635,210		probably benign	Het
Ttc9	C	T	12: 81,631,676	P91L	probably benign	Het
Zbtb18	T	C	1: 177,447,880	S269P	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het
Zfyve16	A	T	13: 92,513,902	V858E	probably damaging	Het

Other mutations in Col22a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Col22a1	APN	15	71860958	critical splice donor site	probably null
IGL00434:Col22a1	APN	15	72006675	missense	possibly damaging	0.71
IGL00721:Col22a1	APN	15	71846177	missense	unknown
IGL00902:Col22a1	APN	15	71964659	missense	probably damaging	1.00
IGL01311:Col22a1	APN	15	71973637	splice site	probably benign
IGL01329:Col22a1	APN	15	71907040	missense	probably benign	0.02
IGL01527:Col22a1	APN	15	71907031	missense	probably damaging	0.98
IGL01870:Col22a1	APN	15	71952528	missense	probably benign	0.07
IGL02002:Col22a1	APN	15	71811097	splice site	probably benign
IGL02248:Col22a1	APN	15	71799448	missense	unknown
IGL02322:Col22a1	APN	15	71822653	missense	unknown
IGL02472:Col22a1	APN	15	71827753	splice site	probably benign
IGL02685:Col22a1	APN	15	71801915	missense	unknown
IGL02888:Col22a1	APN	15	71846219	missense	unknown
IGL02971:Col22a1	APN	15	72006738	missense	probably damaging	1.00
IGL03175:Col22a1	APN	15	71969103	missense	possibly damaging	0.81
IGL03240:Col22a1	APN	15	71807928	missense	unknown
R0083:Col22a1	UTSW	15	71890497	missense	possibly damaging	0.70
R0383:Col22a1	UTSW	15	71869004	missense	unknown
R0449:Col22a1	UTSW	15	71962671	critical splice donor site	probably null
R0508:Col22a1	UTSW	15	71933413	missense	unknown
R0944:Col22a1	UTSW	15	71881662	missense	probably benign	0.03
R1289:Col22a1	UTSW	15	71837377	missense	unknown
R1436:Col22a1	UTSW	15	71922957	splice site	probably benign
R1439:Col22a1	UTSW	15	71952377	splice site	probably benign
R1460:Col22a1	UTSW	15	71821931	missense	unknown
R1680:Col22a1	UTSW	15	71799361	missense	unknown
R1715:Col22a1	UTSW	15	72006981	missense	possibly damaging	0.79
R1742:Col22a1	UTSW	15	71801913	missense	unknown
R1745:Col22a1	UTSW	15	72006787	missense	probably damaging	1.00
R1763:Col22a1	UTSW	15	72007176	missense	probably damaging	0.96
R1932:Col22a1	UTSW	15	71870140	missense	unknown
R2125:Col22a1	UTSW	15	71848577	missense	unknown
R2126:Col22a1	UTSW	15	71857253	nonsense	probably null
R2137:Col22a1	UTSW	15	72006948	missense	possibly damaging	0.46
R2860:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R2861:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R2862:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R3704:Col22a1	UTSW	15	71970307	missense	probably damaging	1.00
R3778:Col22a1	UTSW	15	71973692	missense	probably damaging	1.00
R3940:Col22a1	UTSW	15	71981933	nonsense	probably null
R3950:Col22a1	UTSW	15	71977358	missense	possibly damaging	0.90
R4240:Col22a1	UTSW	15	72007131	missense	probably damaging	1.00
R4531:Col22a1	UTSW	15	72007149	missense	probably damaging	1.00
R4597:Col22a1	UTSW	15	71964662	missense	possibly damaging	0.83
R4604:Col22a1	UTSW	15	71952339	missense	probably benign	0.36
R4654:Col22a1	UTSW	15	71973695	missense	possibly damaging	0.95
R4782:Col22a1	UTSW	15	71801925	missense	unknown
R4847:Col22a1	UTSW	15	71799499	missense	unknown
R4980:Col22a1	UTSW	15	71801943	missense	unknown
R4981:Col22a1	UTSW	15	71861066	missense	unknown
R4996:Col22a1	UTSW	15	72007161	missense	probably damaging	0.99
R5007:Col22a1	UTSW	15	71944422	missense	probably damaging	1.00
R5135:Col22a1	UTSW	15	71799337	missense	unknown
R5197:Col22a1	UTSW	15	72009406	missense	probably damaging	0.96
R5292:Col22a1	UTSW	15	71970336	missense	probably damaging	1.00
R5449:Col22a1	UTSW	15	71821949	missense	unknown
R5480:Col22a1	UTSW	15	71964611	missense	probably damaging	0.98
R5627:Col22a1	UTSW	15	71981918	missense	probably damaging	0.98
R5927:Col22a1	UTSW	15	72006966	missense	probably damaging	1.00
R6006:Col22a1	UTSW	15	71973836	missense	probably damaging	1.00
R6245:Col22a1	UTSW	15	71973816	missense	probably damaging	0.99
R6288:Col22a1	UTSW	15	71894869	critical splice acceptor site	probably null
R6482:Col22a1	UTSW	15	71890489	missense	possibly damaging	0.93
R6497:Col22a1	UTSW	15	71890576	missense	possibly damaging	0.85
R6579:Col22a1	UTSW	15	71881653	missense	probably benign	0.18
R6643:Col22a1	UTSW	15	71822037	intron	probably null
R6663:Col22a1	UTSW	15	71820059	missense	unknown
R7179:Col22a1	UTSW	15	71933413	missense	unknown
R7215:Col22a1	UTSW	15	71970332	nonsense	probably null
R7216:Col22a1	UTSW	15	71973845	missense	probably damaging	1.00
R7505:Col22a1	UTSW	15	71799399	nonsense	probably null
R7585:Col22a1	UTSW	15	71892205	missense	probably damaging	0.99
R7788:Col22a1	UTSW	15	71952317	critical splice donor site	probably null
X0066:Col22a1	UTSW	15	71801879	missense	unknown
X0066:Col22a1	UTSW	15	71846200	missense	unknown
Y5406:Col22a1	UTSW	15	71799515	missense	unknown
Z1177:Col22a1	UTSW	15	71915120	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CTACACTGCTGACACTCTGGT -3'
(R):5'- GAAGGTCACACTCTTGACTCTGG -3'

Sequencing Primer
(F):5'- CTGGTACACTCAGTCAGTCAG -3'
(R):5'- GTACCTGGATGTAGGATTCCTCC -3'

Posted On

2016-12-20