Incidental Mutation 'R5828:Fchsd1'
ID450299
Institutional Source Beutler Lab
Gene Symbol Fchsd1
Ensembl Gene ENSMUSG00000038524
Gene NameFCH and double SH3 domains 1
SynonymsA030002D08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R5828 (G1)
Quality Score222
Status Validated
Chromosome18
Chromosomal Location37957431-37969774 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 37959873 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043437] [ENSMUST00000043498] [ENSMUST00000070709] [ENSMUST00000091932] [ENSMUST00000163128] [ENSMUST00000163591] [ENSMUST00000168056] [ENSMUST00000169360] [ENSMUST00000169498] [ENSMUST00000176104] [ENSMUST00000176902] [ENSMUST00000177058]
Predicted Effect probably benign
Transcript: ENSMUST00000043437
SMART Domains Protein: ENSMUSP00000047878
Gene: ENSMUSG00000038524

DomainStartEndE-ValueType
Pfam:FCH 21 100 1.6e-19 PFAM
coiled coil region 188 209 N/A INTRINSIC
low complexity region 346 357 N/A INTRINSIC
SH3 469 526 1.34e-8 SMART
SH3 547 606 1.94e-14 SMART
low complexity region 622 634 N/A INTRINSIC
low complexity region 657 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043498
SMART Domains Protein: ENSMUSP00000037981
Gene: ENSMUSG00000024454

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 11 315 1.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070709
SMART Domains Protein: ENSMUSP00000070280
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 1.2e-22 PFAM
low complexity region 194 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091932
SMART Domains Protein: ENSMUSP00000089552
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 8.3e-23 PFAM
low complexity region 194 212 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153945
Predicted Effect probably benign
Transcript: ENSMUST00000163128
SMART Domains Protein: ENSMUSP00000127234
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 5.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163591
SMART Domains Protein: ENSMUSP00000129299
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
low complexity region 103 121 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166727
Predicted Effect probably benign
Transcript: ENSMUST00000168056
SMART Domains Protein: ENSMUSP00000130051
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 1.9e-23 PFAM
low complexity region 104 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169360
SMART Domains Protein: ENSMUSP00000129880
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 4.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169498
SMART Domains Protein: ENSMUSP00000128949
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
low complexity region 103 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176104
SMART Domains Protein: ENSMUSP00000135556
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 60 3.3e-22 PFAM
low complexity region 194 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176902
SMART Domains Protein: ENSMUSP00000135176
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
low complexity region 103 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177058
SMART Domains Protein: ENSMUSP00000135615
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 1.2e-22 PFAM
low complexity region 194 212 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,601,800 D95G unknown Het
Arl10 T A 13: 54,578,955 V182E probably damaging Het
Cacna1g T G 11: 94,457,154 S703R probably damaging Het
Ces2a C A 8: 104,739,324 T363N probably benign Het
Col14a1 G A 15: 55,436,976 V967I unknown Het
Col22a1 A T 15: 72,009,491 F4I probably benign Het
D630045J12Rik A G 6: 38,196,367 W289R possibly damaging Het
Disc1 A G 8: 125,251,024 Q793R probably damaging Het
Dnhd1 C T 7: 105,720,181 T4337I probably benign Het
Eif2b5 T A 16: 20,502,786 V363D possibly damaging Het
Emsy T C 7: 98,593,492 T1147A probably benign Het
Epg5 T A 18: 78,020,851 Y2048N probably damaging Het
Foxred1 A G 9: 35,210,196 probably benign Het
Gpaa1 T C 15: 76,332,271 probably benign Het
Gria4 A C 9: 4,432,832 L784V probably damaging Het
Homer3 A G 8: 70,286,306 Y105C probably benign Het
Hpgd T C 8: 56,319,071 S193P probably benign Het
Irf1 T A 11: 53,775,936 W247R probably benign Het
Lpgat1 A G 1: 191,776,382 Q344R possibly damaging Het
Luzp1 T C 4: 136,540,682 V72A probably damaging Het
Malrd1 G A 2: 15,526,653 V8M probably benign Het
Msmo1 T C 8: 64,719,110 H253R probably damaging Het
Nom1 A G 5: 29,435,126 K150R possibly damaging Het
Olfr310 T A 7: 86,269,520 M90L probably benign Het
Olfr360 A G 2: 37,068,989 H228R probably benign Het
Olfr483 T C 7: 108,103,798 V163A possibly damaging Het
Onecut1 A G 9: 74,862,760 E155G probably benign Het
Osbpl10 G A 9: 115,061,876 V111M probably damaging Het
Pcdhgb6 T C 18: 37,744,404 S722P probably benign Het
Plin4 T A 17: 56,107,064 D187V probably damaging Het
Pmf1 T C 3: 88,395,987 E89G possibly damaging Het
Polr1d A T 5: 147,077,598 probably benign Het
Ppp1r9a T C 6: 5,158,200 Y1006H probably damaging Het
Ppp2r5c A G 12: 110,570,700 K420E probably benign Het
Prdx1 T C 4: 116,693,809 L159P probably damaging Het
Psmd6 G T 14: 14,119,990 D39E probably benign Het
Rffl T C 11: 82,818,418 K60E probably damaging Het
Rspo2 A T 15: 43,075,887 L169Q probably damaging Het
Sbf1 T A 15: 89,288,634 D1892V probably damaging Het
Sbno2 G A 10: 80,066,590 S475F possibly damaging Het
Serpina3i T A 12: 104,265,215 V37E probably benign Het
Siglecf G A 7: 43,351,713 C35Y probably damaging Het
Slc22a27 G T 19: 7,926,402 D123E probably damaging Het
Smim23 T A 11: 32,820,592 K105* probably null Het
Soat1 C T 1: 156,437,748 S348N probably benign Het
Sp2 C T 11: 96,960,985 probably benign Het
St14 T A 9: 31,091,507 H700L probably damaging Het
St3gal1 T A 15: 67,113,785 K7* probably null Het
Tgm1 T C 14: 55,705,554 K610E probably benign Het
Tob1 T A 11: 94,213,757 Y40N probably damaging Het
Tob1 T A 11: 94,213,759 Y40* probably null Het
Trpc4ap A G 2: 155,635,210 probably benign Het
Ttc9 C T 12: 81,631,676 P91L probably benign Het
Zbtb18 T C 1: 177,447,880 S269P probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfyve16 A T 13: 92,513,902 V858E probably damaging Het
Other mutations in Fchsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Fchsd1 APN 18 37965893 intron probably benign
IGL01097:Fchsd1 APN 18 37967757 splice site probably null
IGL02069:Fchsd1 APN 18 37967614 nonsense probably null
R0015:Fchsd1 UTSW 18 37962959 missense probably benign 0.05
R0015:Fchsd1 UTSW 18 37962959 missense probably benign 0.05
R0755:Fchsd1 UTSW 18 37968750 splice site probably null
R1524:Fchsd1 UTSW 18 37965897 critical splice donor site probably null
R2041:Fchsd1 UTSW 18 37967676 critical splice acceptor site probably null
R3820:Fchsd1 UTSW 18 37969457 splice site probably benign
R3821:Fchsd1 UTSW 18 37969457 splice site probably benign
R4998:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5017:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5018:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5022:Fchsd1 UTSW 18 37964810 missense possibly damaging 0.80
R5023:Fchsd1 UTSW 18 37964810 missense possibly damaging 0.80
R5047:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5240:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5309:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5312:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5353:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5354:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5355:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5424:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5517:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5518:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5521:Fchsd1 UTSW 18 37966484 missense probably damaging 1.00
R5590:Fchsd1 UTSW 18 37961327 missense probably damaging 1.00
R5607:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5608:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5810:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5906:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5949:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5958:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5969:Fchsd1 UTSW 18 37959873 unclassified probably benign
R6245:Fchsd1 UTSW 18 37962775 missense probably damaging 1.00
R6322:Fchsd1 UTSW 18 37965700 missense probably benign 0.00
R6433:Fchsd1 UTSW 18 37964084 missense possibly damaging 0.91
R6439:Fchsd1 UTSW 18 37969434 missense probably damaging 0.97
R6460:Fchsd1 UTSW 18 37959844 splice site probably null
R6488:Fchsd1 UTSW 18 37967268 intron probably null
R6650:Fchsd1 UTSW 18 37966502 nonsense probably null
R7331:Fchsd1 UTSW 18 37968770 missense possibly damaging 0.95
X0024:Fchsd1 UTSW 18 37969391 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCTGTCTTAGGAATATCCCTGAC -3'
(R):5'- TCAATAGGCATTTTGAGGGGC -3'

Sequencing Primer
(F):5'- GTCTTAGGAATATCCCTGACAATTC -3'
(R):5'- TTTATAGCTTAGGCTGCTG -3'
Posted On2016-12-20