Incidental Mutation 'R5829:Epha4'
ID450303
Institutional Source Beutler Lab
Gene Symbol Epha4
Ensembl Gene ENSMUSG00000026235
Gene NameEph receptor A4
Synonymsrb, Sek, Sek1, 2900005C20Rik, Cek8, Hek8, Tyro1
Accession Numbers

Genbank: NM_007936; MGI: 98277

Is this an essential gene? Probably essential (E-score: 0.895) question?
Stock #R5829 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location77367185-77515088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 77444994 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 284 (L284F)
Ref Sequence ENSEMBL: ENSMUSP00000139640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027451] [ENSMUST00000186930] [ENSMUST00000188797] [ENSMUST00000188952] [ENSMUST00000190149]
PDB Structure
THE CRYSTAL STRUCTURE OF AN EPH RECEPTOR SAM DOMAIN REVEALS A MECHANISM FOR MODULAR DIMERIZATION. [X-RAY DIFFRACTION]
Crystal structure of a mutant EphA4 kinase domain (Y742A) [X-RAY DIFFRACTION]
[]
Crystal structure of EphA4 kinase domain in complex with VUF 12058 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF EPHA4 KINASE DOMAIN [X-RAY DIFFRACTION]
Crystal structure of EphA4 kinase domain in complex with Dasatinib. [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027451
AA Change: L284F

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000027451
Gene: ENSMUSG00000026235
AA Change: L284F

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 548 618 1.7e-24 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186930
SMART Domains Protein: ENSMUSP00000140370
Gene: ENSMUSG00000026235

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
FN3 33 124 9.6e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188797
AA Change: L284F

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000140954
Gene: ENSMUSG00000026235
AA Change: L284F

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 547 618 1.8e-27 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188952
AA Change: L284F

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000139640
Gene: ENSMUSG00000026235
AA Change: L284F

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 547 618 1.8e-27 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189934
Predicted Effect probably benign
Transcript: ENSMUST00000190149
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mutants are known for their "hopping gait". Homozygotes for targeted null mutations show loss of limb alternation in locomotion and axon guidance defects of the corticospinal tract within medulla and spinal cord, resulting in aberrant midline projections. Heterozygotes show less severe phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(66) : Targeted, knock-out(3) Targeted, other(9) Gene trapped(52) Spontaneous(2)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Atp6v1e2 T C 17: 86,944,716 R85G probably benign Het
Bmpr1b T C 3: 141,845,157 H391R probably benign Het
Camsap3 A G 8: 3,597,899 H69R probably damaging Het
Col12a1 C T 9: 79,633,673 G2391R probably damaging Het
Dab2ip ATCCT ATCCTCCT 2: 35,707,775 probably benign Het
Fam166a G A 2: 25,218,857 probably null Het
Fat4 T C 3: 39,007,305 S4346P probably damaging Het
Fbxo22 T A 9: 55,218,312 probably null Het
Gcc1 C A 6: 28,419,691 probably benign Het
Gdf10 T C 14: 33,932,717 S394P probably damaging Het
Gdf9 C T 11: 53,433,689 T95M probably benign Het
Gm884 C T 11: 103,541,886 E1310K possibly damaging Het
Gpr179 G A 11: 97,335,698 S1877L probably benign Het
Gtf2i A G 5: 134,263,693 V380A probably damaging Het
Il17c G A 8: 122,422,231 R38Q probably damaging Het
Il17rd G A 14: 27,092,085 probably null Het
Iqch C T 9: 63,425,357 probably null Het
Mpp4 A T 1: 59,128,942 S456R probably damaging Het
Nek10 T C 14: 14,865,404 Y601H probably damaging Het
Nrxn2 C T 19: 6,490,849 P936L probably benign Het
Olfr907 T A 9: 38,499,249 Y193* probably null Het
Pcdhb9 T C 18: 37,401,889 V312A probably damaging Het
Pex5l T C 3: 33,005,990 T211A probably benign Het
Pik3c2a T C 7: 116,372,814 T794A probably benign Het
Pla2g6 A G 15: 79,287,693 F710L possibly damaging Het
Repin1 A T 6: 48,594,832 probably benign Het
Rev3l A T 10: 39,806,906 E340V probably damaging Het
Ryr3 A G 2: 112,859,731 S1158P probably damaging Het
S100a16 A T 3: 90,542,147 Q43L possibly damaging Het
Scg2 A G 1: 79,436,920 S29P probably damaging Het
Sfrp5 T C 19: 42,201,656 Y119C probably damaging Het
Sh3tc2 A G 18: 61,990,915 T916A probably benign Het
Smpd3 A G 8: 106,264,880 V347A probably benign Het
Tmem212 C A 3: 27,884,932 C135F possibly damaging Het
Unc13c T A 9: 73,693,368 N1365Y probably benign Het
Usp13 G T 3: 32,886,523 G395C possibly damaging Het
Vmn2r68 T C 7: 85,237,604 N34S probably benign Het
Other mutations in Epha4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Epha4 APN 1 77398557 missense probably benign 0.00
IGL01350:Epha4 APN 1 77506855 missense probably damaging 1.00
IGL01657:Epha4 APN 1 77426838 missense probably damaging 1.00
IGL01872:Epha4 APN 1 77383039 missense probably benign 0.03
IGL02366:Epha4 APN 1 77426711 nonsense probably null
IGL02426:Epha4 APN 1 77444877 missense probably benign 0.01
IGL02428:Epha4 APN 1 77506748 missense possibly damaging 0.94
IGL02706:Epha4 APN 1 77426845 missense probably damaging 1.00
IGL02716:Epha4 APN 1 77380965 missense probably damaging 1.00
IGL03348:Epha4 APN 1 77507172 missense possibly damaging 0.82
frog UTSW 1 77481076 intron probably benign
R0324:Epha4 UTSW 1 77383551 missense probably damaging 1.00
R0392:Epha4 UTSW 1 77506973 missense probably benign 0.00
R0538:Epha4 UTSW 1 77388541 missense probably damaging 1.00
R0562:Epha4 UTSW 1 77388487 missense probably benign 0.00
R0885:Epha4 UTSW 1 77382939 missense probably damaging 0.99
R1509:Epha4 UTSW 1 77380886 missense probably damaging 1.00
R1620:Epha4 UTSW 1 77374926 missense probably benign 0.31
R1624:Epha4 UTSW 1 77399692 missense probably damaging 1.00
R1654:Epha4 UTSW 1 77374768 splice site probably null
R1755:Epha4 UTSW 1 77387823 missense probably damaging 1.00
R1807:Epha4 UTSW 1 77374904 missense probably benign 0.05
R2046:Epha4 UTSW 1 77507162 missense probably damaging 1.00
R2504:Epha4 UTSW 1 77382991 missense probably damaging 1.00
R2509:Epha4 UTSW 1 77511702 missense possibly damaging 0.84
R2511:Epha4 UTSW 1 77511702 missense possibly damaging 0.84
R3441:Epha4 UTSW 1 77426696 missense possibly damaging 0.90
R3724:Epha4 UTSW 1 77426543 splice site probably benign
R3901:Epha4 UTSW 1 77380902 missense probably damaging 1.00
R3950:Epha4 UTSW 1 77399716 missense probably damaging 1.00
R3951:Epha4 UTSW 1 77399716 missense probably damaging 1.00
R3952:Epha4 UTSW 1 77399716 missense probably damaging 1.00
R4012:Epha4 UTSW 1 77390094 splice site probably benign
R4321:Epha4 UTSW 1 77507213 critical splice acceptor site probably null
R4422:Epha4 UTSW 1 77511717 missense probably damaging 0.99
R4898:Epha4 UTSW 1 77390075 nonsense probably null
R5072:Epha4 UTSW 1 77445002 missense probably damaging 1.00
R5270:Epha4 UTSW 1 77506607 missense probably damaging 1.00
R5281:Epha4 UTSW 1 77374867 missense probably benign
R5315:Epha4 UTSW 1 77388472 critical splice donor site probably null
R5531:Epha4 UTSW 1 77374876 missense probably benign
R5621:Epha4 UTSW 1 77515049 utr 5 prime probably benign
R5648:Epha4 UTSW 1 77398525 missense probably benign 0.25
R5747:Epha4 UTSW 1 77506883 missense probably damaging 0.99
R6185:Epha4 UTSW 1 77507106 missense probably damaging 1.00
R6486:Epha4 UTSW 1 77383549 missense probably damaging 1.00
R6821:Epha4 UTSW 1 77382945 missense possibly damaging 0.88
R6978:Epha4 UTSW 1 77377583 missense probably damaging 1.00
R7039:Epha4 UTSW 1 77506785 missense probably damaging 1.00
R7216:Epha4 UTSW 1 77444984 missense probably damaging 1.00
R7270:Epha4 UTSW 1 77399785 missense probably damaging 1.00
R7444:Epha4 UTSW 1 77387916 missense probably damaging 1.00
R7737:Epha4 UTSW 1 77381012 missense probably damaging 1.00
R7763:Epha4 UTSW 1 77390031 critical splice donor site probably null
R7950:Epha4 UTSW 1 77507196 missense probably damaging 0.99
R8297:Epha4 UTSW 1 77506910 missense probably damaging 1.00
R8373:Epha4 UTSW 1 77507079 missense possibly damaging 0.60
R8429:Epha4 UTSW 1 77390036 missense probably benign 0.08
Z1088:Epha4 UTSW 1 77506662 missense possibly damaging 0.61
Z1176:Epha4 UTSW 1 77373733 makesense probably null
Z1176:Epha4 UTSW 1 77383011 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTATCCTGGGAGAAAGTCCTG -3'
(R):5'- TGATTGAACCTGCATTTTAAGCCAG -3'

Sequencing Primer
(F):5'- CCCTGCTAGGTGGTAATGAGAGC -3'
(R):5'- GAACCTGCATTTTAAGCCAGGTGATC -3'
Posted On2016-12-20