Incidental Mutation 'R5829:Fam166a'
ID450307
Institutional Source Beutler Lab
Gene Symbol Fam166a
Ensembl Gene ENSMUSG00000026969
Gene Namefamily with sequence similarity 166, member A
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5829 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25218745-25222280 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 25218857 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028346] [ENSMUST00000043584] [ENSMUST00000043774] [ENSMUST00000114363]
Predicted Effect probably null
Transcript: ENSMUST00000028346
SMART Domains Protein: ENSMUSP00000028346
Gene: ENSMUSG00000026969

DomainStartEndE-ValueType
Pfam:DUF2475 13 71 8.1e-16 PFAM
low complexity region 130 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043584
SMART Domains Protein: ENSMUSP00000042342
Gene: ENSMUSG00000036752

DomainStartEndE-ValueType
Tubulin 47 244 1.04e-67 SMART
Tubulin_C 246 383 3.89e-49 SMART
low complexity region 428 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043774
SMART Domains Protein: ENSMUSP00000037603
Gene: ENSMUSG00000036770

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 103 145 9.5e-4 PFAM
Pfam:SHIPPO-rpt 226 255 1.4e-3 PFAM
Pfam:SHIPPO-rpt 265 291 1.4e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114363
SMART Domains Protein: ENSMUSP00000110003
Gene: ENSMUSG00000036770

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 48 79 2.8e-4 PFAM
Pfam:SHIPPO-rpt 110 136 1.2e-1 PFAM
Pfam:SHIPPO-rpt 152 200 3.5e-1 PFAM
Pfam:SHIPPO-rpt 210 248 1.9e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149509
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Atp6v1e2 T C 17: 86,944,716 R85G probably benign Het
Bmpr1b T C 3: 141,845,157 H391R probably benign Het
Camsap3 A G 8: 3,597,899 H69R probably damaging Het
Col12a1 C T 9: 79,633,673 G2391R probably damaging Het
Dab2ip ATCCT ATCCTCCT 2: 35,707,775 probably benign Het
Epha4 G A 1: 77,444,994 L284F probably benign Het
Fat4 T C 3: 39,007,305 S4346P probably damaging Het
Fbxo22 T A 9: 55,218,312 probably null Het
Gcc1 C A 6: 28,419,691 probably benign Het
Gdf10 T C 14: 33,932,717 S394P probably damaging Het
Gdf9 C T 11: 53,433,689 T95M probably benign Het
Gm884 C T 11: 103,541,886 E1310K possibly damaging Het
Gpr179 G A 11: 97,335,698 S1877L probably benign Het
Gtf2i A G 5: 134,263,693 V380A probably damaging Het
Il17c G A 8: 122,422,231 R38Q probably damaging Het
Il17rd G A 14: 27,092,085 probably null Het
Iqch C T 9: 63,425,357 probably null Het
Mpp4 A T 1: 59,128,942 S456R probably damaging Het
Nek10 T C 14: 14,865,404 Y601H probably damaging Het
Nrxn2 C T 19: 6,490,849 P936L probably benign Het
Olfr907 T A 9: 38,499,249 Y193* probably null Het
Pcdhb9 T C 18: 37,401,889 V312A probably damaging Het
Pex5l T C 3: 33,005,990 T211A probably benign Het
Pik3c2a T C 7: 116,372,814 T794A probably benign Het
Pla2g6 A G 15: 79,287,693 F710L possibly damaging Het
Repin1 A T 6: 48,594,832 probably benign Het
Rev3l A T 10: 39,806,906 E340V probably damaging Het
Ryr3 A G 2: 112,859,731 S1158P probably damaging Het
S100a16 A T 3: 90,542,147 Q43L possibly damaging Het
Scg2 A G 1: 79,436,920 S29P probably damaging Het
Sfrp5 T C 19: 42,201,656 Y119C probably damaging Het
Sh3tc2 A G 18: 61,990,915 T916A probably benign Het
Smpd3 A G 8: 106,264,880 V347A probably benign Het
Tmem212 C A 3: 27,884,932 C135F possibly damaging Het
Unc13c T A 9: 73,693,368 N1365Y probably benign Het
Usp13 G T 3: 32,886,523 G395C possibly damaging Het
Vmn2r68 T C 7: 85,237,604 N34S probably benign Het
Other mutations in Fam166a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Fam166a APN 2 25220333 missense possibly damaging 0.90
IGL01712:Fam166a APN 2 25218792 unclassified probably benign
IGL03056:Fam166a APN 2 25221355 missense possibly damaging 0.73
IGL03232:Fam166a APN 2 25221739 nonsense probably null
R0368:Fam166a UTSW 2 25220673 missense probably benign
R0761:Fam166a UTSW 2 25220123 unclassified probably benign
R1997:Fam166a UTSW 2 25220205 missense probably damaging 1.00
R2106:Fam166a UTSW 2 25220651 missense probably damaging 0.99
R4575:Fam166a UTSW 2 25220288 missense probably benign 0.00
R4576:Fam166a UTSW 2 25220288 missense probably benign 0.00
R4577:Fam166a UTSW 2 25220288 missense probably benign 0.00
R4578:Fam166a UTSW 2 25220288 missense probably benign 0.00
R5896:Fam166a UTSW 2 25220566 missense probably benign
R6618:Fam166a UTSW 2 25220623 missense probably benign 0.02
R6905:Fam166a UTSW 2 25220479 missense probably benign 0.00
R7178:Fam166a UTSW 2 25220240 missense probably damaging 0.99
R7636:Fam166a UTSW 2 25218820 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGATGGCTGGGTCCATAATG -3'
(R):5'- ATTCAGGTTGAGGCCACAGG -3'

Sequencing Primer
(F):5'- TGGGTCCATAATGCTGCCC -3'
(R):5'- CTCAGAGTTTTCCTGTCCCAGAG -3'
Posted On2016-12-20