Incidental Mutation 'R5829:Tmem212'
ID450310
Institutional Source Beutler Lab
Gene Symbol Tmem212
Ensembl Gene ENSMUSG00000043164
Gene Nametransmembrane protein 212
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5829 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location27866066-27896368 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 27884932 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 135 (C135F)
Ref Sequence ENSEMBL: ENSMUSP00000049832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058077]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058077
AA Change: C135F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049832
Gene: ENSMUSG00000043164
AA Change: C135F

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
transmembrane domain 41 63 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 146 168 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Atp6v1e2 T C 17: 86,944,716 R85G probably benign Het
Bmpr1b T C 3: 141,845,157 H391R probably benign Het
Camsap3 A G 8: 3,597,899 H69R probably damaging Het
Col12a1 C T 9: 79,633,673 G2391R probably damaging Het
Dab2ip ATCCT ATCCTCCT 2: 35,707,775 probably benign Het
Epha4 G A 1: 77,444,994 L284F probably benign Het
Fam166a G A 2: 25,218,857 probably null Het
Fat4 T C 3: 39,007,305 S4346P probably damaging Het
Fbxo22 T A 9: 55,218,312 probably null Het
Gcc1 C A 6: 28,419,691 probably benign Het
Gdf10 T C 14: 33,932,717 S394P probably damaging Het
Gdf9 C T 11: 53,433,689 T95M probably benign Het
Gm884 C T 11: 103,541,886 E1310K possibly damaging Het
Gpr179 G A 11: 97,335,698 S1877L probably benign Het
Gtf2i A G 5: 134,263,693 V380A probably damaging Het
Il17c G A 8: 122,422,231 R38Q probably damaging Het
Il17rd G A 14: 27,092,085 probably null Het
Iqch C T 9: 63,425,357 probably null Het
Mpp4 A T 1: 59,128,942 S456R probably damaging Het
Nek10 T C 14: 14,865,404 Y601H probably damaging Het
Nrxn2 C T 19: 6,490,849 P936L probably benign Het
Olfr907 T A 9: 38,499,249 Y193* probably null Het
Pcdhb9 T C 18: 37,401,889 V312A probably damaging Het
Pex5l T C 3: 33,005,990 T211A probably benign Het
Pik3c2a T C 7: 116,372,814 T794A probably benign Het
Pla2g6 A G 15: 79,287,693 F710L possibly damaging Het
Repin1 A T 6: 48,594,832 probably benign Het
Rev3l A T 10: 39,806,906 E340V probably damaging Het
Ryr3 A G 2: 112,859,731 S1158P probably damaging Het
S100a16 A T 3: 90,542,147 Q43L possibly damaging Het
Scg2 A G 1: 79,436,920 S29P probably damaging Het
Sfrp5 T C 19: 42,201,656 Y119C probably damaging Het
Sh3tc2 A G 18: 61,990,915 T916A probably benign Het
Smpd3 A G 8: 106,264,880 V347A probably benign Het
Unc13c T A 9: 73,693,368 N1365Y probably benign Het
Usp13 G T 3: 32,886,523 G395C possibly damaging Het
Vmn2r68 T C 7: 85,237,604 N34S probably benign Het
Other mutations in Tmem212
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1444:Tmem212 UTSW 3 27885095 missense possibly damaging 0.95
R1522:Tmem212 UTSW 3 27886471 nonsense probably null
R1630:Tmem212 UTSW 3 27885101 missense possibly damaging 0.82
R1727:Tmem212 UTSW 3 27884812 missense probably benign 0.33
R2437:Tmem212 UTSW 3 27886479 missense possibly damaging 0.94
R3104:Tmem212 UTSW 3 27884870 missense probably damaging 1.00
R3105:Tmem212 UTSW 3 27884870 missense probably damaging 1.00
R3106:Tmem212 UTSW 3 27884870 missense probably damaging 1.00
R3790:Tmem212 UTSW 3 27886445 splice site probably null
R4824:Tmem212 UTSW 3 27885008 missense probably damaging 1.00
R6407:Tmem212 UTSW 3 27884839 missense probably benign 0.01
R7685:Tmem212 UTSW 3 27896313 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTGTTCAGGACCTAGCAAG -3'
(R):5'- CAGGTAACAGTTCGTTTCTGC -3'

Sequencing Primer
(F):5'- GTTCAGGACCTAGCAAGCCCAG -3'
(R):5'- TCAGTGGGAAGCCGTGTTCAC -3'
Posted On2016-12-20