Incidental Mutation 'R5829:Pex5l'
ID450312
Institutional Source Beutler Lab
Gene Symbol Pex5l
Ensembl Gene ENSMUSG00000027674
Gene Nameperoxisomal biogenesis factor 5-like
SynonymsPex2, PXR2, TRIP8b, 1700016J08Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.389) question?
Stock #R5829 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location32949408-33143247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33005990 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 211 (T211A)
Ref Sequence ENSEMBL: ENSMUSP00000142196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078226] [ENSMUST00000108224] [ENSMUST00000108225] [ENSMUST00000108226] [ENSMUST00000192093] [ENSMUST00000193289] [ENSMUST00000193681] [ENSMUST00000194016]
Predicted Effect probably benign
Transcript: ENSMUST00000078226
AA Change: T176A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077353
Gene: ENSMUSG00000027674
AA Change: T176A

DomainStartEndE-ValueType
low complexity region 113 129 N/A INTRINSIC
low complexity region 214 228 N/A INTRINSIC
TPR 349 382 6.95e-4 SMART
Blast:TPR 383 416 4e-14 BLAST
TPR 463 496 3.19e-3 SMART
TPR 497 530 3.47e-4 SMART
TPR 531 564 1.1e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108219
SMART Domains Protein: ENSMUSP00000103854
Gene: ENSMUSG00000027674

DomainStartEndE-ValueType
low complexity region 124 140 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
PDB:4EQF|A 266 362 8e-64 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000108224
AA Change: T152A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103859
Gene: ENSMUSG00000027674
AA Change: T152A

DomainStartEndE-ValueType
low complexity region 88 104 N/A INTRINSIC
low complexity region 190 204 N/A INTRINSIC
TPR 325 358 6.95e-4 SMART
Blast:TPR 359 392 2e-14 BLAST
TPR 439 472 3.19e-3 SMART
TPR 473 506 3.47e-4 SMART
TPR 507 540 1.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108225
AA Change: T176A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103860
Gene: ENSMUSG00000027674
AA Change: T176A

DomainStartEndE-ValueType
low complexity region 113 129 N/A INTRINSIC
low complexity region 214 228 N/A INTRINSIC
TPR 349 382 6.95e-4 SMART
Blast:TPR 383 416 4e-14 BLAST
TPR 463 496 3.19e-3 SMART
TPR 497 530 3.47e-4 SMART
TPR 531 564 1.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108226
AA Change: T128A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103861
Gene: ENSMUSG00000027674
AA Change: T128A

DomainStartEndE-ValueType
low complexity region 65 81 N/A INTRINSIC
low complexity region 166 180 N/A INTRINSIC
TPR 301 334 6.95e-4 SMART
Blast:TPR 335 368 2e-14 BLAST
TPR 415 448 3.19e-3 SMART
TPR 449 482 3.47e-4 SMART
TPR 483 516 1.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192093
AA Change: T176A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141387
Gene: ENSMUSG00000027674
AA Change: T176A

DomainStartEndE-ValueType
low complexity region 113 129 N/A INTRINSIC
low complexity region 214 228 N/A INTRINSIC
TPR 349 382 6.95e-4 SMART
Blast:TPR 383 416 4e-14 BLAST
TPR 463 496 3.19e-3 SMART
TPR 497 530 3.47e-4 SMART
TPR 531 564 1.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193289
AA Change: T211A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142008
Gene: ENSMUSG00000027674
AA Change: T211A

DomainStartEndE-ValueType
low complexity region 148 164 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
TPR 384 417 6.95e-4 SMART
Blast:TPR 418 451 4e-14 BLAST
TPR 498 531 3.19e-3 SMART
TPR 532 565 3.47e-4 SMART
TPR 566 599 1.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193681
AA Change: T211A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141454
Gene: ENSMUSG00000027674
AA Change: T211A

DomainStartEndE-ValueType
low complexity region 148 164 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
TPR 384 417 6.95e-4 SMART
Blast:TPR 418 451 4e-14 BLAST
TPR 498 531 3.19e-3 SMART
TPR 532 565 3.47e-4 SMART
TPR 566 599 1.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194016
AA Change: T211A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142196
Gene: ENSMUSG00000027674
AA Change: T211A

DomainStartEndE-ValueType
low complexity region 148 164 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
TPR 384 417 6.95e-4 SMART
Blast:TPR 418 451 4e-14 BLAST
TPR 498 531 3.19e-3 SMART
TPR 532 565 3.47e-4 SMART
TPR 566 599 1.1e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted mutation lacking isoform b exhibit exhibit reduced hyperpolarization-activated current in CA1 pyramidal neuron, impaired motor learning, impaired nest-building, decreased startle reflex, and decreased depression-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Atp6v1e2 T C 17: 86,944,716 R85G probably benign Het
Bmpr1b T C 3: 141,845,157 H391R probably benign Het
Camsap3 A G 8: 3,597,899 H69R probably damaging Het
Col12a1 C T 9: 79,633,673 G2391R probably damaging Het
Dab2ip ATCCT ATCCTCCT 2: 35,707,775 probably benign Het
Epha4 G A 1: 77,444,994 L284F probably benign Het
Fam166a G A 2: 25,218,857 probably null Het
Fat4 T C 3: 39,007,305 S4346P probably damaging Het
Fbxo22 T A 9: 55,218,312 probably null Het
Gcc1 C A 6: 28,419,691 probably benign Het
Gdf10 T C 14: 33,932,717 S394P probably damaging Het
Gdf9 C T 11: 53,433,689 T95M probably benign Het
Gm884 C T 11: 103,541,886 E1310K possibly damaging Het
Gpr179 G A 11: 97,335,698 S1877L probably benign Het
Gtf2i A G 5: 134,263,693 V380A probably damaging Het
Il17c G A 8: 122,422,231 R38Q probably damaging Het
Il17rd G A 14: 27,092,085 probably null Het
Iqch C T 9: 63,425,357 probably null Het
Mpp4 A T 1: 59,128,942 S456R probably damaging Het
Nek10 T C 14: 14,865,404 Y601H probably damaging Het
Nrxn2 C T 19: 6,490,849 P936L probably benign Het
Olfr907 T A 9: 38,499,249 Y193* probably null Het
Pcdhb9 T C 18: 37,401,889 V312A probably damaging Het
Pik3c2a T C 7: 116,372,814 T794A probably benign Het
Pla2g6 A G 15: 79,287,693 F710L possibly damaging Het
Repin1 A T 6: 48,594,832 probably benign Het
Rev3l A T 10: 39,806,906 E340V probably damaging Het
Ryr3 A G 2: 112,859,731 S1158P probably damaging Het
S100a16 A T 3: 90,542,147 Q43L possibly damaging Het
Scg2 A G 1: 79,436,920 S29P probably damaging Het
Sfrp5 T C 19: 42,201,656 Y119C probably damaging Het
Sh3tc2 A G 18: 61,990,915 T916A probably benign Het
Smpd3 A G 8: 106,264,880 V347A probably benign Het
Tmem212 C A 3: 27,884,932 C135F possibly damaging Het
Unc13c T A 9: 73,693,368 N1365Y probably benign Het
Usp13 G T 3: 32,886,523 G395C possibly damaging Het
Vmn2r68 T C 7: 85,237,604 N34S probably benign Het
Other mutations in Pex5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Pex5l APN 3 32952597 missense probably damaging 1.00
IGL01621:Pex5l APN 3 33014961 splice site probably null
IGL01813:Pex5l APN 3 33082055 missense probably benign 0.02
IGL02313:Pex5l APN 3 32992992 missense probably benign 0.22
IGL02508:Pex5l APN 3 32992902 splice site probably benign
IGL02997:Pex5l APN 3 32955842 splice site probably benign
R0195:Pex5l UTSW 3 32992953 missense possibly damaging 0.87
R0674:Pex5l UTSW 3 32952616 missense probably damaging 1.00
R0729:Pex5l UTSW 3 32954536 splice site probably benign
R1500:Pex5l UTSW 3 33014980 missense probably damaging 1.00
R1513:Pex5l UTSW 3 33015013 nonsense probably null
R1695:Pex5l UTSW 3 32954382 missense probably benign 0.28
R1850:Pex5l UTSW 3 32950876 splice site probably null
R2165:Pex5l UTSW 3 32953132 splice site probably null
R2679:Pex5l UTSW 3 33082052 missense probably benign 0.02
R2880:Pex5l UTSW 3 32993003 critical splice acceptor site probably null
R2881:Pex5l UTSW 3 32993003 critical splice acceptor site probably null
R3766:Pex5l UTSW 3 33007178 missense probably benign 0.01
R3780:Pex5l UTSW 3 32950844 missense probably damaging 1.00
R3934:Pex5l UTSW 3 33007172 missense probably damaging 1.00
R3975:Pex5l UTSW 3 33015015 missense probably damaging 0.99
R4285:Pex5l UTSW 3 33007187 missense probably damaging 1.00
R4825:Pex5l UTSW 3 32992985 missense probably damaging 0.99
R4855:Pex5l UTSW 3 33142840 splice site probably benign
R4868:Pex5l UTSW 3 32952490 missense probably damaging 1.00
R5135:Pex5l UTSW 3 32955831 missense probably damaging 1.00
R5217:Pex5l UTSW 3 33007328 splice site probably null
R5223:Pex5l UTSW 3 32958796 missense probably damaging 1.00
R5362:Pex5l UTSW 3 32992916 missense probably damaging 1.00
R5398:Pex5l UTSW 3 32952490 missense probably damaging 1.00
R6731:Pex5l UTSW 3 32958798 missense probably damaging 1.00
R7180:Pex5l UTSW 3 33024691 splice site probably null
R7452:Pex5l UTSW 3 33004318 missense probably benign 0.02
R7549:Pex5l UTSW 3 33082035 missense probably benign 0.04
R7563:Pex5l UTSW 3 32954476 missense probably damaging 0.98
R7757:Pex5l UTSW 3 33082151 start gained probably benign
R8030:Pex5l UTSW 3 32954419 missense possibly damaging 0.93
R8143:Pex5l UTSW 3 33082509 start gained probably benign
R8242:Pex5l UTSW 3 33006035 missense probably benign 0.01
Z1177:Pex5l UTSW 3 33007159 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGGAAGTGATAGCATATAGATTGC -3'
(R):5'- AATCTTAGCCTTGGGTCTAAGACAC -3'

Sequencing Primer
(F):5'- TTAATCCAGACTCCTTAGATATCTGG -3'
(R):5'- GACACATGGACTGCATATAGTTTGCC -3'
Posted On2016-12-20