Incidental Mutation 'R0549:Ccl3'
ID45032
Institutional Source Beutler Lab
Gene Symbol Ccl3
Ensembl Gene ENSMUSG00000000982
Gene Namechemokine (C-C motif) ligand 3
SynonymsMIP-1alpha, MIP1-alpha, G0S19-1, LD78alpha, Mip1a, macrophage inflammatory protein-1alpha, Scya3, MIP-1 alpha, CCL3, MIP1-(a)
MMRRC Submission 038741-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0549 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location83647844-83649355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83648336 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 66 (T66A)
Ref Sequence ENSEMBL: ENSMUSP00000001008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001008] [ENSMUST00000182502]
Predicted Effect probably damaging
Transcript: ENSMUST00000001008
AA Change: T66A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001008
Gene: ENSMUSG00000000982
AA Change: T66A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SCY 31 88 2.25e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117199
Predicted Effect probably benign
Transcript: ENSMUST00000182502
SMART Domains Protein: ENSMUSP00000138342
Gene: ENSMUSG00000081906

DomainStartEndE-ValueType
Pfam:Ribosomal_L6 12 87 1.2e-16 PFAM
Pfam:Ribosomal_L6 119 177 6.8e-9 PFAM
Meta Mutation Damage Score 0.6985 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of several cytokine genes that are clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins that function in inflammatory and immunoregulatory processes. The protein encoded by this gene binds to several chemokine receptors, including chemokine binding protein 2 and chemokine (C-C motif) receptor 5 (CCR5). CCR5 is a co-receptor for HIV, and binding of this protein to CCR5 inhibits HIV entry. The copy number of this gene varies among individuals, where most individuals have one to six copies, and a minority of individuals have zero or more than six copies. There are conflicting reports about copy number variation of this gene and its correlation to disease susceptibility.[provided by RefSeq, Apr 2014]
PHENOTYPE: Animals homozygous for a mutation in this gene exhibit resistance to Coxsackie virus-induced myocarditis and reduced pneumonitis following infection with influenza virus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,322,290 F498L probably damaging Het
Adamts6 A T 13: 104,297,255 D64V possibly damaging Het
Agbl2 T C 2: 90,789,843 probably benign Het
Angptl3 A G 4: 99,031,455 S151G probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
C4b G T 17: 34,735,415 L927I probably damaging Het
Cdh7 T C 1: 110,108,944 L618P probably damaging Het
Cfap65 T C 1: 74,918,444 T989A probably benign Het
Cnpy4 T C 5: 138,187,637 F18S possibly damaging Het
Col6a5 A G 9: 105,904,579 probably benign Het
Dppa2 G A 16: 48,318,671 R289H probably benign Het
Evx2 T C 2: 74,659,134 T96A probably benign Het
Frmd4a A G 2: 4,603,967 E577G possibly damaging Het
Gcgr G A 11: 120,536,561 G166S probably benign Het
Gm4788 A T 1: 139,739,488 D377E probably damaging Het
Gm5316 T C 6: 122,900,191 noncoding transcript Het
Gria1 G A 11: 57,228,973 R292Q probably damaging Het
Hars2 T A 18: 36,786,208 probably null Het
Hkdc1 T A 10: 62,400,240 T508S probably benign Het
Kif2b A T 11: 91,576,584 I291N probably damaging Het
Lmbrd1 A T 1: 24,744,920 T377S probably benign Het
Lrrc28 A G 7: 67,628,342 probably benign Het
Mmp3 A T 9: 7,455,638 N463I probably benign Het
Myh6 A G 14: 54,958,608 F578S probably damaging Het
Ncbp1 T A 4: 46,168,476 M608K possibly damaging Het
Nf1 T C 11: 79,468,771 F1412L probably damaging Het
Nlrp5 T A 7: 23,441,802 W1083R probably damaging Het
Nrsn1 T C 13: 25,262,258 Y45C probably benign Het
Olfr401 T G 11: 74,121,475 M62R probably damaging Het
Osbpl7 G T 11: 97,067,542 R881L probably damaging Het
Papss1 A G 3: 131,619,213 E456G possibly damaging Het
Pbxip1 T A 3: 89,443,592 probably benign Het
Pcca A G 14: 122,638,377 probably benign Het
Pde1a T A 2: 79,865,070 N511I probably damaging Het
Prpf39 A T 12: 65,056,256 I435F probably benign Het
Rnf213 C T 11: 119,465,082 T4117M probably damaging Het
Sel1l2 A T 2: 140,265,882 M216K probably damaging Het
Sidt2 A G 9: 45,953,119 probably null Het
Sirt3 A T 7: 140,869,487 probably null Het
Smpd4 T C 16: 17,639,312 V378A probably benign Het
Svil T A 18: 5,064,566 S642T possibly damaging Het
Tcp10a A G 17: 7,326,551 K92E probably benign Het
Tmem144 T C 3: 79,822,744 D233G probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnik T C 3: 28,570,920 S335P possibly damaging Het
Ush2a T C 1: 188,946,953 L4786P probably damaging Het
Utp11 A T 4: 124,686,079 probably benign Het
Vmn1r67 A G 7: 10,447,714 N241D probably damaging Het
Vmn2r11 A T 5: 109,052,097 C497S possibly damaging Het
Other mutations in Ccl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Ccl3 APN 11 83648641 missense possibly damaging 0.80
R4583:Ccl3 UTSW 11 83648338 missense probably benign 0.06
R5664:Ccl3 UTSW 11 83649213 missense probably benign 0.02
R5713:Ccl3 UTSW 11 83649240 missense possibly damaging 0.87
R6680:Ccl3 UTSW 11 83648306 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAAACAGTGTGACCAACTGGGAG -3'
(R):5'- CCCAGCCAGGTGTCATGTAAGTTC -3'

Sequencing Primer
(F):5'- taaaattTCAAGTGAAGAGTCCCTCG -3'
(R):5'- ACAGTGTAAGAGAGGGTTTTTCAGTC -3'
Posted On2013-06-11