Incidental Mutation 'R5829:Fbxo22'
ID450327
Institutional Source Beutler Lab
Gene Symbol Fbxo22
Ensembl Gene ENSMUSG00000032309
Gene NameF-box protein 22
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5829 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location55208925-55224433 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 55218312 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034859] [ENSMUST00000130158] [ENSMUST00000133795] [ENSMUST00000133795] [ENSMUST00000137675] [ENSMUST00000140375] [ENSMUST00000145784] [ENSMUST00000146201] [ENSMUST00000146201] [ENSMUST00000153970] [ENSMUST00000164721]
Predicted Effect probably null
Transcript: ENSMUST00000034859
SMART Domains Protein: ENSMUSP00000034859
Gene: ENSMUSG00000032309

DomainStartEndE-ValueType
Pfam:F-box 22 66 1.7e-6 PFAM
FIST_C 231 365 2.61e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126368
Predicted Effect probably benign
Transcript: ENSMUST00000130158
SMART Domains Protein: ENSMUSP00000115247
Gene: ENSMUSG00000032311

DomainStartEndE-ValueType
EGF 8 46 4.78e-3 SMART
transmembrane domain 61 83 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000133795
Predicted Effect probably null
Transcript: ENSMUST00000133795
Predicted Effect probably benign
Transcript: ENSMUST00000137675
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139261
Predicted Effect probably benign
Transcript: ENSMUST00000140375
SMART Domains Protein: ENSMUSP00000117341
Gene: ENSMUSG00000032309

DomainStartEndE-ValueType
Pfam:F-box 21 66 3e-8 PFAM
Pfam:F-box-like 26 66 4.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144939
Predicted Effect probably benign
Transcript: ENSMUST00000145784
SMART Domains Protein: ENSMUSP00000115851
Gene: ENSMUSG00000032311

DomainStartEndE-ValueType
Blast:EGF 8 35 9e-13 BLAST
SCOP:d1jl9a_ 9 35 6e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000146201
SMART Domains Protein: ENSMUSP00000117106
Gene: ENSMUSG00000032309

DomainStartEndE-ValueType
FIST_C 128 262 2.61e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000146201
SMART Domains Protein: ENSMUSP00000117106
Gene: ENSMUSG00000032309

DomainStartEndE-ValueType
FIST_C 128 262 2.61e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153970
Predicted Effect probably benign
Transcript: ENSMUST00000164721
SMART Domains Protein: ENSMUSP00000130929
Gene: ENSMUSG00000032311

DomainStartEndE-ValueType
EGF 8 46 4.78e-3 SMART
transmembrane domain 61 83 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and, as a transcriptional target of the tumor protein p53, is thought to be involved in degradation of specific proteins in response to p53 induction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Atp6v1e2 T C 17: 86,944,716 R85G probably benign Het
Bmpr1b T C 3: 141,845,157 H391R probably benign Het
Camsap3 A G 8: 3,597,899 H69R probably damaging Het
Col12a1 C T 9: 79,633,673 G2391R probably damaging Het
Dab2ip ATCCT ATCCTCCT 2: 35,707,775 probably benign Het
Epha4 G A 1: 77,444,994 L284F probably benign Het
Fam166a G A 2: 25,218,857 probably null Het
Fat4 T C 3: 39,007,305 S4346P probably damaging Het
Gcc1 C A 6: 28,419,691 probably benign Het
Gdf10 T C 14: 33,932,717 S394P probably damaging Het
Gdf9 C T 11: 53,433,689 T95M probably benign Het
Gm884 C T 11: 103,541,886 E1310K possibly damaging Het
Gpr179 G A 11: 97,335,698 S1877L probably benign Het
Gtf2i A G 5: 134,263,693 V380A probably damaging Het
Il17c G A 8: 122,422,231 R38Q probably damaging Het
Il17rd G A 14: 27,092,085 probably null Het
Iqch C T 9: 63,425,357 probably null Het
Mpp4 A T 1: 59,128,942 S456R probably damaging Het
Nek10 T C 14: 14,865,404 Y601H probably damaging Het
Nrxn2 C T 19: 6,490,849 P936L probably benign Het
Olfr907 T A 9: 38,499,249 Y193* probably null Het
Pcdhb9 T C 18: 37,401,889 V312A probably damaging Het
Pex5l T C 3: 33,005,990 T211A probably benign Het
Pik3c2a T C 7: 116,372,814 T794A probably benign Het
Pla2g6 A G 15: 79,287,693 F710L possibly damaging Het
Repin1 A T 6: 48,594,832 probably benign Het
Rev3l A T 10: 39,806,906 E340V probably damaging Het
Ryr3 A G 2: 112,859,731 S1158P probably damaging Het
S100a16 A T 3: 90,542,147 Q43L possibly damaging Het
Scg2 A G 1: 79,436,920 S29P probably damaging Het
Sfrp5 T C 19: 42,201,656 Y119C probably damaging Het
Sh3tc2 A G 18: 61,990,915 T916A probably benign Het
Smpd3 A G 8: 106,264,880 V347A probably benign Het
Tmem212 C A 3: 27,884,932 C135F possibly damaging Het
Unc13c T A 9: 73,693,368 N1365Y probably benign Het
Usp13 G T 3: 32,886,523 G395C possibly damaging Het
Vmn2r68 T C 7: 85,237,604 N34S probably benign Het
Other mutations in Fbxo22
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4342:Fbxo22 UTSW 9 55221070 unclassified probably null
FR4737:Fbxo22 UTSW 9 55209382 missense probably damaging 1.00
R0112:Fbxo22 UTSW 9 55223346 missense probably benign 0.00
R0414:Fbxo22 UTSW 9 55223626 missense possibly damaging 0.86
R0634:Fbxo22 UTSW 9 55214960 missense probably benign 0.43
R0694:Fbxo22 UTSW 9 55221139 missense probably damaging 0.99
R1799:Fbxo22 UTSW 9 55223487 missense probably benign 0.00
R1958:Fbxo22 UTSW 9 55209342 unclassified probably null
R2060:Fbxo22 UTSW 9 55218383 missense probably damaging 0.97
R2850:Fbxo22 UTSW 9 55223415 missense probably damaging 1.00
R3883:Fbxo22 UTSW 9 55223262 missense probably benign
R4649:Fbxo22 UTSW 9 55221049 missense probably damaging 1.00
R7260:Fbxo22 UTSW 9 55218470 missense probably benign 0.00
R7329:Fbxo22 UTSW 9 55214977 missense probably benign 0.01
R7838:Fbxo22 UTSW 9 55218367 missense probably damaging 1.00
R7921:Fbxo22 UTSW 9 55218367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCATCTGGACTCCACAGC -3'
(R):5'- GTAACTTACCTACTTCAGTAAGCTGG -3'

Sequencing Primer
(F):5'- CCACAGCTGCTCAGTTTGTAAAG -3'
(R):5'- ACTTCAGTAAGCTGGTGTCTTTC -3'
Posted On2016-12-20